Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10402

Ptpro protein tyrosine phosphatase, receptor type, O ( MGI:1097152)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402
"Pseudo-wholemount" of euxassay_000528. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000528_01 euxassay_000528_02 euxassay_000528_03 euxassay_000528_04
EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402
euxassay_000528_05 euxassay_000528_06 euxassay_000528_07 euxassay_000528_08 euxassay_000528_09
EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402
euxassay_000528_10 euxassay_000528_11 euxassay_000528_12 euxassay_000528_13 euxassay_000528_14
EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402
euxassay_000528_15 euxassay_000528_16 euxassay_000528_17 euxassay_000528_18 euxassay_000528_19
EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402 EMAGE:10402
euxassay_000528_20 euxassay_000528_21 euxassay_000528_22 euxassay_000528_23 euxassay_000528_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10402Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10402_wholemount_strong.wlz
10402_wholemount_moderate.wlz
10402_wholemount_weak.wlz
10402_wholemount_possible.wlz
10402_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10402_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus
moderate moderate
regionalmoderate expression: see section 05 09 13 14 15
cerebral cortex
strong strong
regionalstrong expression: see section 19 20 21 22 23 24 weak expression: see section 01
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 04 05 06 07 16 17 18 19
corpus striatum
strong strong
regionalstrong expression: see section 22 weak expression: see section 20
telencephalon marginal layer
strong strong
regionalstrong expression: see section 03
olfactory cortex
strong strong
regionalstrong expression: see section 19 20 21
olfactory cortex marginal layer
strong strong
regionalstrong expression: see section 02 03 04 05 16 17 18
metencephalon lateral wall
moderate moderate
regionalmoderate expression: see section 09
midbrain lateral wall
strong strong
spottedstrong expression: see section 04 05 06 07 13 14 15 moderate expression: see section 09
testis
strong strong
spottedstrong expression: see section 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2303
Entity Detected:Ptpro, protein tyrosine phosphatase, receptor type, O ( MGI:1097152)
Sequence:sense strand is shown

>T2303
GGCCTCGAGCCAGATTCGTCGACATGTCAGCCAGCTTATCTTTTCCTATTTCAAATATGAAAACCTGTGT
TTCAAAGTAGAGTAGGAAAAACATTATATGTCTGACTTGTCATAGTGGGTTTCTTCCTTGTTGACAGTTG
GGAGTTTCTTCCGTGGCTCTTTTGAACTAATGTCACAGTCCTTTTTGAACAGCCAGAGTTGATTCAACAG
TTTTGAGTCTGACTCTGAACTCTGAGATATCTTGGTGCCTAGCCTTCACGTTTATTTTTCTCTGTGTCCA
CCTGTGTACACAAAAACAGTTTCTCCAAGAGCTATAGGCTGTAAAAATGCACTTTCTTTCCCCACCCAGA
GGAGCTGGGAATTCAGAAGTCACGACAACAACAAACTCAGCATGTAAGGACAGGTATTGGACACCATCCC
TTAAGAACATTGTTGAGCGTCTCTATGGATTCCGACAGGAGATTCTCTGGGTCTTCTTTGCATTTCTGTT
GTCAGAGTCATTTTAACCTGTGTAGCTAGTGGCATTATATTCTTTGGATTTTGTATGATTAAAGTACATG
ATTGTGTGTT
Notes:The probe template was PCR amplified from IMAGE:1137535 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1137535 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4827531 same experiment
 EurExpress:euxassay_000528 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS