EMAGE mouse gene expression spatial database

EMAGE:10747

Clca5 chloride channel calcium activated 5 ( MGI:2139758)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_001039. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_001039_01	euxassay_001039_02	euxassay_001039_03	euxassay_001039_04

euxassay_001039_05	euxassay_001039_06	euxassay_001039_07	euxassay_001039_08	euxassay_001039_09

euxassay_001039_10	euxassay_001039_11	euxassay_001039_12	euxassay_001039_13	euxassay_001039_14

euxassay_001039_15	euxassay_001039_16	euxassay_001039_17	euxassay_001039_18	euxassay_001039_19

euxassay_001039_20	euxassay_001039_21	euxassay_001039_22

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

chondrocranium

weak

regional

weak expression: see section 01 02 03 04 05 06 21 22

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T227
Entity Detected:	Clca5, chloride channel calcium activated 5 ( MGI:2139758)
Sequence:	sense strand is shown >T227 GTACCCAGCAGGCTCCCCGTGAATAAACCAGAGGTTTCACTGCAAGATGACCCACAGGGNACAGCACAGG ACCTGTCATCGGGCTGAAACTTGTGACCCTTCTGTTCACCCTAAGTCCAGAACTTCTGTTCCTGGGAGCT GGATTGAAGCTGAAAGAGAATGGCTATGATGGATTGCTTGTTGCCATCAATCCCCGGGTACCCGAGGATC TGAAGCTGATTACAAACATTAAGGAAATGATAACCGAAGCTTCCTTTTACCTGTTCAATGCGACCAAGAG GAGGGTGTTTTTCAGAAATGTACAGATTTTAGTACCTGCCACTTGGACGGATCATAATTACAGTAGAGTA AGACAAGAATCCTATGACAAGGCAAATGTCATAGTGGCTGAGCAGAGTGAGGAACACGGAGATGATCCCT ACACCCTACAGCACAGAGGGTGTGGGCAAGAGGGGAGATACATCCACTTCACCCCCAGCTTCCTACTCAA CGATGAGTTAGCCGCAG
Notes:	The probe template was PCR amplified from IMAGE:2650226 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2650226 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10748 same embryo
	EMAGE:10745 same embryo
	EMAGE:10750 same embryo
	EMAGE:10749 same embryo
	EMAGE:10746 same embryo
	EurExpress:euxassay_001039 same experiment
	MGI:4823897 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source