Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10957

Slc22a12 solute carrier family 22 (organic anion/cation transporter), member 12 ( MGI:1195269)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10957 EMAGE:10957 EMAGE:10957 EMAGE:10957 EMAGE:10957
"Pseudo-wholemount" of euxassay_003608. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003608_01 euxassay_003608_02 euxassay_003608_03 euxassay_003608_04
EMAGE:10957 EMAGE:10957 EMAGE:10957 EMAGE:10957 EMAGE:10957
euxassay_003608_05 euxassay_003608_06 euxassay_003608_07 euxassay_003608_08 euxassay_003608_09
EMAGE:10957 EMAGE:10957 EMAGE:10957 EMAGE:10957 EMAGE:10957
euxassay_003608_10 euxassay_003608_11 euxassay_003608_12 euxassay_003608_13 euxassay_003608_14
EMAGE:10957 EMAGE:10957 EMAGE:10957 EMAGE:10957 EMAGE:10957
euxassay_003608_15 euxassay_003608_16 euxassay_003608_17 euxassay_003608_18 euxassay_003608_19
EMAGE:10957 EMAGE:10957 EMAGE:10957 EMAGE:10957
euxassay_003608_20 euxassay_003608_21 euxassay_003608_22 euxassay_003608_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10957Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10957_wholemount_strong.wlz
10957_wholemount_moderate.wlz
10957_wholemount_weak.wlz
10957_wholemount_possible.wlz
10957_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10957_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 18 19 20 21 22 weak expression: see section 03 04 09 10 11 12 15 16 17 23
facial vii ganglion
weak weak
regionalweak expression: see section 22 23
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 09 21
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 10 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 10 20
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 08 09 19 20 21
dorsal root ganglion
weak weak
regionalweak expression: see section 11 12 13 16 17 18 19 20 21
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T6297
Entity Detected:Slc22a12, solute carrier family 22 (organic anion/cation transporter), member 12 ( MGI:1195269)
Sequence:sense strand is shown

>T6297
AGCCTTGACTGGCTGTGACTCAGCAACATGGCTGTGTGACATGCATATGAAGAGACTGGTGTGGTCAGAG
CCAAGGGGAAAGCAGGCTCATCACAAAGACCCCATGGTCCTGGGCCAGCCTCTGTGAAGTGGAAGCTGCG
TGGTGGTACCCAGGAGAAACCCATGGCCTTTCCTGAACTCCTGGACCGAGTGGGGGGGCTGGGCAGGTTC
CAGCTCTTCCAGACGGTGGCTCTGGTGACCCCCATTTTGTGGGTCACCACCCAGAACATGCTGGAGAACT
TCTCAGCCGCAGTTCCCCACCACCGCTGTTGGGTGCCTCTCCTGGACAATAGCACCTCCCAGGCGAGTAT
CCCTGGGGACCTTGGACCCGATGTTCTTCTGGCCGTCTCCATCCCACCTGGTCCTGACCAGCAACCCCAC
CAGTGCCTCCGCTTCCGACAACCTCAATGGCAGCTTACAGAGTCCAACGCCACGGCCACCAACTGGAGTG
ACGCTGCCACTGAGCCATGCGAGGATGGCTGGGTTTACGACCACAGCACCTTCAGGTCCACAATCGTGAC
TATAGTGT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGATTACCACAGAGGGTTCC; Reverse Primer - name:unspecified, sequence:TCACGATTGTGGACCTGAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10955 same embryo
 EMAGE:10953 same embryo
 EMAGE:10956 same embryo
 EMAGE:10952 same embryo
 EMAGE:10954 same embryo
 EurExpress:euxassay_003608 same experiment
 MGI:4828131 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS