Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11876

Lrp1 low density lipoprotein receptor-related protein 1 ( MGI:96828)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11876 EMAGE:11876 EMAGE:11876 EMAGE:11876 EMAGE:11876
"Pseudo-wholemount" of euxassay_011128. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011128_01 euxassay_011128_02 euxassay_011128_03 euxassay_011128_04
EMAGE:11876 EMAGE:11876 EMAGE:11876 EMAGE:11876 EMAGE:11876
euxassay_011128_05 euxassay_011128_06 euxassay_011128_07 euxassay_011128_08 euxassay_011128_09
EMAGE:11876 EMAGE:11876 EMAGE:11876 EMAGE:11876 EMAGE:11876
euxassay_011128_10 euxassay_011128_11 euxassay_011128_12 euxassay_011128_13 euxassay_011128_14
EMAGE:11876 EMAGE:11876 EMAGE:11876 EMAGE:11876 EMAGE:11876
euxassay_011128_15 euxassay_011128_16 euxassay_011128_17 euxassay_011128_18 euxassay_011128_19
EMAGE:11876 EMAGE:11876 EMAGE:11876
euxassay_011128_20 euxassay_011128_21 euxassay_011128_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11876Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11876_wholemount_strong.wlz
11876_wholemount_moderate.wlz
11876_wholemount_weak.wlz
11876_wholemount_possible.wlz
11876_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11876_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 10 11 12
pons ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 13 14 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36595
Entity Detected:Lrp1, low density lipoprotein receptor-related protein 1 ( MGI:96828)
Sequence:sense strand is shown

>T36595
GGTAGTTGTTTCCTCAACGCTCGGAGGCAGCCCAAGTGCCGTTGCCAGCCCCGTTACACAGGCGATAAGT
GTGAGCTGGATCAGTGCTGGGAATACTGTCACAACGGAGGCACCTGTGCGGCTTCCCCATCTGGCATGCC
CACGTGCCGCTGTCCCACTGGCTTCACGGGCCCCAAATGCACCGCACAGGTGTGTGCAGGCTACTGCTCT
AACAACAGCACCTGCACCGTCAACCAGGGCAACCAGCCCCAGTGCCGATGTCTACCTGGCTTCCTGGGCG
ACCGTTGCCAGTACCGGCAGTGCTCTGGCTTCTGTGAGAACTTTGGCACCTGTCAGATGGCTGCTGATGG
CTCCCGACAATGTCGCTGCACCGTCTACTTTGAGGGACCAAGGTGTGAGGTGAACAAGTGTAGTCGCTGT
CTCCAAGGCGCCTGTGTGGTCAATAAGCAGACCGGAGATGTCACATGCAACTGCACTGATGGCCGGGTAG
CCCCCAGTTGTCTCACCTGCATCGATCACTGTAGCAATGGTGGCTCCTGCACCATGAACAGCAAGATGAT
GCCTGAGTGCCAGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98054. Forward Primer - name:098054_F_cDNA_Lrp1, sequence:GGTAGTTGTTTCCTCAACGCTC; Reverse Primer - name:098054_N_SP6_cDNA_Lrp1, sequence:ACTGGCACTCAGGCATCATCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11875 same embryo
 EMAGE:11874 same embryo
 EMAGE:11878 same embryo
 EMAGE:11877 same embryo
 EMAGE:11879 same embryo
 EurExpress:euxassay_011128 same experiment
 MGI:4825979 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS