Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15809

Rtn4rl2 reticulon 4 receptor-like 2 ( MGI:2669796)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15809 EMAGE:15809 EMAGE:15809 EMAGE:15809 EMAGE:15809
"Pseudo-wholemount" of euxassay_013217. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013217_01 euxassay_013217_02 euxassay_013217_03 euxassay_013217_04
EMAGE:15809 EMAGE:15809 EMAGE:15809 EMAGE:15809 EMAGE:15809
euxassay_013217_05 euxassay_013217_06 euxassay_013217_07 euxassay_013217_08 euxassay_013217_09
EMAGE:15809 EMAGE:15809 EMAGE:15809 EMAGE:15809 EMAGE:15809
euxassay_013217_10 euxassay_013217_11 euxassay_013217_12 euxassay_013217_13 euxassay_013217_14
EMAGE:15809 EMAGE:15809 EMAGE:15809 EMAGE:15809 EMAGE:15809
euxassay_013217_15 euxassay_013217_16 euxassay_013217_17 euxassay_013217_18 euxassay_013217_19
EMAGE:15809 EMAGE:15809 EMAGE:15809 EMAGE:15809
euxassay_013217_20 euxassay_013217_21 euxassay_013217_22 euxassay_013217_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15809Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15809_wholemount_strong.wlz
15809_wholemount_moderate.wlz
15809_wholemount_weak.wlz
15809_wholemount_possible.wlz
15809_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15809_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
cerebral cortex marginal layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 10 11 12 13 15 17 18 19 20 21 22 23
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 10 11 12 15
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 05 18
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 17 18 19 20
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 07 17
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39061
Entity Detected:Rtn4rl2, reticulon 4 receptor-like 2 ( MGI:2669796)
Sequence:sense strand is shown

>T39061
CTAGAAGAACTGGACCTCGGTGACAACCGGCACCTGCGCTCCCTGGAGCCCGACACCTTCCAGGGTCTGG
AGAGGCTGCAGTCACTACACCTGTATCGTTGCCAGCTCAGCAGCCTGCCTGGCAACATTTTCCGAGGCTT
GGTCAGCCTACAGTACCTCTACCTCCAGGAGAACAGCCTGCTCCATCTACAGGATGACTTGTTCGCGGAC
CTGGCCAACCTGAGCCACCTCTTCCTCCACGGGAACCGCCTGCGGCTGCTCACGGAGCACGTGTTCCGCG
GCTTGGGCAGCCTGGACCGGCTGTTGCTGCACGGGAACCGGCTGCAGGGCGTGCACCGCGCGGCTTTCCA
CGGCCTCAGCCGCCTCACCATCCTCTACCTGTTCAACAACAGCCTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 95821. Forward Primer - name:095821_F_cDNA_Rtn4rl2, sequence:CTAGAAGAACTGGACCTCGGTG; Reverse Primer - name:095821_N_SP6_cDNA_Rtn4rl2, sequence:CCAGGCTGTTGTTGAACAGGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15810 same embryo
 EMAGE:15813 same embryo
 EMAGE:15812 same embryo
 EMAGE:15814 same embryo
 EMAGE:15811 same embryo
 EurExpress:euxassay_013217 same experiment
 MGI:4827832 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS