Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18589

Nlrp4c NLR family, pyrin domain containing 4C ( MGI:1890518)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589
"Pseudo-wholemount" of euxassay_014541. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014541_01 euxassay_014541_02 euxassay_014541_03 euxassay_014541_04
EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589
euxassay_014541_05 euxassay_014541_06 euxassay_014541_07 euxassay_014541_08 euxassay_014541_09
EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589
euxassay_014541_10 euxassay_014541_11 euxassay_014541_12 euxassay_014541_13 euxassay_014541_14
EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589
euxassay_014541_15 euxassay_014541_16 euxassay_014541_17 euxassay_014541_18 euxassay_014541_19
EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589 EMAGE:18589
euxassay_014541_20 euxassay_014541_21 euxassay_014541_22 euxassay_014541_23 euxassay_014541_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18589Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18589_wholemount_strong.wlz
18589_wholemount_moderate.wlz
18589_wholemount_weak.wlz
18589_wholemount_possible.wlz
18589_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18589_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 05 18 19
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 05 06 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 16
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07 17
spinal cord
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38583
Entity Detected:Nlrp4c, NLR family, pyrin domain containing 4C ( MGI:1890518)
Sequence:sense strand is shown

>T38583
CTCCAAAAGAAAGAGAGCAGGATCCTTAATTTGGCCCATTATATACAAAAATTACAGGTCACTAACATTC
CAATGAGATACATACAGTTTCTTTACCTCCCCCCCCATTCAGATGTGTTTTGCAAGATAGATGTGACTTT
TTGTTTGCACTACAGATTCAAACAGGCCATTCAAAGACAGTTATGGTAAAATGTCTGCCATATAATGACA
GTTTTTCACACACTTGTATTCTAAGCATACAATAAAGTTACTTTTAAAGATAAAAGTATCTTTAGAAATC
CCTTAAGAAGAGATTTGCCTGTTGGTGGATTACTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 150901. Forward Primer - name:150901_F_cDNA_Rnh2, sequence:CTCCAAAAGAAAGAGAGCAGGA; Reverse Primer - name:150901_N_SP6_cDNA_Rnh2, sequence:CAGTAATCCACCAACAGGCAA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18590 same embryo
 EMAGE:18591 same embryo
 EMAGE:18593 same embryo
 EMAGE:18592 same embryo
 EurExpress:euxassay_014541 same experiment
 MGI:4826728 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS