Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20284

Susd2 sushi domain containing 2 ( MGI:1918983)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284
"Pseudo-wholemount" of euxassay_012534. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012534_01 euxassay_012534_02 euxassay_012534_03 euxassay_012534_04
EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284
euxassay_012534_05 euxassay_012534_06 euxassay_012534_07 euxassay_012534_08 euxassay_012534_09
EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284
euxassay_012534_10 euxassay_012534_11 euxassay_012534_12 euxassay_012534_13 euxassay_012534_14
EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284
euxassay_012534_15 euxassay_012534_16 euxassay_012534_17 euxassay_012534_18 euxassay_012534_19
EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284 EMAGE:20284
euxassay_012534_20 euxassay_012534_21 euxassay_012534_22 euxassay_012534_23 euxassay_012534_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20284Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20284_wholemount_strong.wlz
20284_wholemount_moderate.wlz
20284_wholemount_weak.wlz
20284_wholemount_possible.wlz
20284_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20284_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 12 13
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 15 16 17
medulla oblongata basal plate marginal layer
moderate moderate
regionalmoderate expression: see section 14
metencephalon floor plate
moderate moderate
regionalmoderate expression: see section 12 13
pons mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 14 15 16 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31400
Entity Detected:Susd2, sushi domain containing 2 ( MGI:1918983)
Sequence:sense strand is shown

>T31400
TTCTGGCCGCTTCTTCACTGACTATGGTTGTGACATTGAACATGGCAGCGTATGCACCTACCACCCAGGG
GCTGTGCACTGTGTGCGCTCTGTGCAAGCCAGCCCCAGGTATGGCTCAGGCCAGCAATGCTGCTACACGG
CAGCAGGGACACAGCTCCTGACTTCAGACTCGACAAGTGGCAGCACCCCTGACCGTGGCCACGACTGGGG
TGCACCCCCATACCGGACTCCTCCCCGTGTGCCCGGCATGTCTCATTGGCTCTATGACGTCATCAGCTTC
TATTACTGCTGTCTTTGGGCTCCTGAGTGTCCCCGTTATATGAAGCGCCGGCCCTCCAGTGACTGCCGCA
ACTACAGACCCCCACGCCTGGCCTCTGCCTTCGGGGACCCCCATTTTGTCACCTTTGATGGCACCAGCTT
CTCGTTCAGCGGCAATGGCGAATATGTGCTATTGGAGACCACCCTGAGTGATCTGAGAGTGCAGGGCCGG
GCCCAGCCTGGGAGAATGCCCAATGGCACCCAGGCCCGTGGCACAGGGCTGACTGCAGTGGCCGTCCAAG
AAGACAATTCGGATGTGATAGAGGTGCGGTTAGCTGGCGGGTCTCGGGTCTTGGAAGTGTTGCTGAATCA
GAAAGTGCTCAGTTTCACTGAACAAAATTGGATGGACCTGAAGGGCATGTTCCTGTCAGTGGCCGCTCAG
GATAAGGTGTCAATCATGTTGTCATCGGGGGCTGGCCTCGAGGTCGGTGTACAAGGTCCTTTCCTGAGTG
TGAGCATTCTGTTGCCTGAGAAGTTTCTGACCCACACCCG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4222578), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 23046. Forward Primer - name:023046_F_IRAV55-58_M07_Susd2, sequence:TTCTGGCCGCTTCTTCAC; Reverse Primer - name:023046_R_SP6_IRAV55-58_M07_Susd2, sequence:ACGGGTGTGGGTCAGAAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20283 same embryo
 EMAGE:20286 same embryo
 EMAGE:20281 same embryo
 EMAGE:20282 same embryo
 EMAGE:20285 same embryo
 EurExpress:euxassay_012534 same experiment
 MGI:4828543 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS