Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3392

Fgf8 fibroblast growth factor 8 ( MGI:99604)
TS16 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:3392
Figure 6K of Liu et al., 1999 [PMID:10518499] . Copyright: This image is from Liu A, Development 1999;126():4827-38, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: one star
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Note: Red arrowhead points to the rostral boundary of expression.
Expression Pattern Description
Spatial Annotation:
EMAGE:3392EMAGE:3392Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mappingspatial mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
3392_voxel_strong_3D_1.wlz
3392_voxel_possible_3D_1.wlz
3392_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3392_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future hindbrain
detected detected
regionalExpression is in an anterior band. These results are shown schematically in Fig. 8 of Liu A; Losos K; Joyner AL, 1999 [PMID:10518499].
telencephalon
detected detected
regionalThese results are shown schematically in Fig. 8 of Liu A; Losos K; Joyner AL, 1999 [PMID:10518499].
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1334951
Entity Detected:Fgf8, fibroblast growth factor 8 ( MGI:99604)
Sequence:sense strand is shown

>MGI:1334951
AGAACGCCAAGTACGAGGGCTGGTACATGGCCTTTACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGAC
GCGCCAGCATCAGCGCGAGGTGCACTTCATGAAGCGCCTGCCGCGGGGCCACCACACCACCGAGCAGAGC
CTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCCAGAGGACTTGGGCCC
CGGAGCCCCGATAGGCGCTCGCCCAGCTCCTCCCCACCCAGCCGGCCGAGGAATCCAGCGGGAGCTCGGC
GGCACAGCAAAGGGGAGGGGCTGGGGAGCTGCCTTCTAGTTGTGCATATTGTTTGCTGTTGGGTTTTTTT
GTTTTTTGTTTTTTGTTTTTGTTTTTTGTTTTTTAAACAAAAGAGAGGCG
nt 598 - nt 997 of D12482.1
Notes:The Fgf8 probe used in this study by Liu et al., 1999 [PMID:10518499] is referred to in Crossley & Martin, 1995 [PMID:7768185] as a "400nt cDNA probe containing the 3'UTR and C-terminal coding sequences up to the PstI site at nt position 598 in AIGF (Tanaka et al, 1992 [PMID:1409588] )".
Chemistry:RNA
Strand:antisense
Label:S35
Specimen
Organism:mouse
Strain:Swiss Webster
Age:9.5 dpc
Theiler Stage:TS16
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
Staining procedure:autoradiography
General Information
Authors:Liu A; Losos K; Joyner AL, 1999 [PMID:10518499] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10518499] Liu A, Losos K, Joyner AL 1999 FGF8 can activate Gbx2 and transform regions of the rostral mouse brain into a hindbrain fate. Development (126):4827-38
 [ PMID:7768185] Crossley PH, Martin GR 1995 The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development (121):439-51
 [ doi:10.1073/pnas.89.19.8928] [ PMID:1409588] Tanaka A, Miyamoto K, Minamino N, Takeda M, Sato B, Matsuo H, Matsumoto K 1992 Cloning and characterization of an androgen-induced growth factor essential for the androgen-dependent growth of mouse mammary carcinoma cells. Proc Natl Acad Sci U S A (89):8928-32
Links:MGI:1349189 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI