Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3393

Fgf8 fibroblast growth factor 8 ( MGI:99604)
TS12 (5 Somite no.)
in situ hybridisation

Data Images
EMAGE:3393
Figure 7D of Liu et al., 1999 [PMID:10518499] . Copyright: This image is from Liu A, Development 1999;126():4827-38, and is displayed with the permission of The Company of Biologists Limited who owns the Copyright.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Green arrowhead points to the anterior neural plate. Red arrowhead points to the mid/hindbrain junction as defined by the caudal border of Wnt1 and Otx2 expression, and the rostral border of Fgf8 and Gbx2 expression.
Expression Pattern Description
Spatial Annotation:
EMAGE:3393Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3393_wholemount_strong_3D_1.wlz
3393_wholemount_moderate_3D_1.wlz
3393_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3393_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
detected detected
future hindbrain
detected detected
The rostral limit of expression marks the midbrain/hindbrain junction.
future prosencephalon
detected detected
regionalExpression is in the anterior neural ridge.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1334951
Entity Detected:Fgf8, fibroblast growth factor 8 ( MGI:99604)
Sequence:sense strand is shown

>MGI:1334951
AGAACGCCAAGTACGAGGGCTGGTACATGGCCTTTACCCGCAAGGGCCGGCCCCGCAAGGGCTCCAAGAC
GCGCCAGCATCAGCGCGAGGTGCACTTCATGAAGCGCCTGCCGCGGGGCCACCACACCACCGAGCAGAGC
CTGCGCTTCGAGTTCCTCAACTACCCGCCCTTCACGCGCAGCCTGCGCGGCAGCCAGAGGACTTGGGCCC
CGGAGCCCCGATAGGCGCTCGCCCAGCTCCTCCCCACCCAGCCGGCCGAGGAATCCAGCGGGAGCTCGGC
GGCACAGCAAAGGGGAGGGGCTGGGGAGCTGCCTTCTAGTTGTGCATATTGTTTGCTGTTGGGTTTTTTT
GTTTTTTGTTTTTTGTTTTTGTTTTTTGTTTTTTAAACAAAAGAGAGGCG
nt 598 - nt 997 of D12482.1
Notes:The Fgf8 probe used in this study by Liu et al., 1999 [PMID:10518499] is referred to in Crossley & Martin, 1995 [PMID:7768185] as a "400nt cDNA probe containing the 3'UTR and C-terminal coding sequences up to the PstI site at nt position 598 in AIGF (Tanaka et al, 1992 [PMID:1409588] )".
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:Swiss Webster
Age:5 Somite no.
Theiler Stage:TS12
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Liu A; Losos K; Joyner AL, 1999 [PMID:10518499] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10518499] Liu A, Losos K, Joyner AL 1999 FGF8 can activate Gbx2 and transform regions of the rostral mouse brain into a hindbrain fate. Development (126):4827-38
 [ PMID:7768185] Crossley PH, Martin GR 1995 The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development (121):439-51
 [ doi:10.1073/pnas.89.19.8928] [ PMID:1409588] Tanaka A, Miyamoto K, Minamino N, Takeda M, Sato B, Matsuo H, Matsumoto K 1992 Cloning and characterization of an androgen-induced growth factor essential for the androgen-dependent growth of mouse mammary carcinoma cells. Proc Natl Acad Sci U S A (89):8928-32
Links:MGI:1349191 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI