Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10000

1110008P14Rik RIKEN cDNA 1110008P14 gene ( MGI:1920987)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10000 EMAGE:10000 EMAGE:10000 EMAGE:10000 EMAGE:10000
euxassay_000206_01 euxassay_000206_02 euxassay_000206_03 euxassay_000206_04 euxassay_000206_05
EMAGE:10000 EMAGE:10000 EMAGE:10000 EMAGE:10000 EMAGE:10000
euxassay_000206_06 euxassay_000206_07 euxassay_000206_08 euxassay_000206_09 euxassay_000206_10
EMAGE:10000 EMAGE:10000 EMAGE:10000 EMAGE:10000 EMAGE:10000
euxassay_000206_11 euxassay_000206_12 euxassay_000206_13 euxassay_000206_14 euxassay_000206_15
EMAGE:10000 EMAGE:10000 EMAGE:10000 EMAGE:10000 EMAGE:10000
euxassay_000206_16 euxassay_000206_17 euxassay_000206_18 euxassay_000206_19 euxassay_000206_20
EMAGE:10000 EMAGE:10000 EMAGE:10000 EMAGE:10000
euxassay_000206_21 euxassay_000206_22 euxassay_000206_23 euxassay_000206_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10000Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10000_wholemount_strong.wlz
10000_wholemount_moderate.wlz
10000_wholemount_weak.wlz
10000_wholemount_possible.wlz
10000_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10000_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
strong strong
single cellstrong expression: see section 07 08 09 13 14 16 17 18
pons mantle layer
strong strong
single cellstrong expression: see section 07 18
facial vii ganglion
strong strong
single cellstrong expression: see section 05 06 21
glossopharyngeal ix ganglion
strong strong
single cellstrong expression: see section 08 18 20
trigeminal v ganglion
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
strong strong
single cellstrong expression: see section 06 07 09 19 20
ventral grey horn
strong strong
single cellstrong expression: see section 10 11 14 15 16 18
dorsal root ganglion
strong strong
single cellstrong expression: see section 06 07 08 09 11 15 16 17 18 19 20 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T307
Entity Detected:1110008P14Rik, RIKEN cDNA 1110008P14 gene ( MGI:1920987)
Sequence:sense strand is shown

>T307
CGCTTCCGGCCCGGTGCTCAACCAGCTGCTCGCACCTTCCGCCCAGCGCCGGCTTTCCGCGCGACGATCG
CCAAGTTCCATCTTCGCGTGGCCTCTGCGGCGCCCGAGCCCAATGTCGGGCCCCAACGGGGACCTAGGCA
TGCCGGTGGATGCGGGCANGGAAGGAGAGAATGACAGCTTCGGGGAAGCAGAGTATGCTGCCATCAACTC
CATGTTGGATCAGATCAACTCTTGTCTGGACCACCTGGAGGAGAAGAATGACCACCTCCATGCCCGCCTC
CAGGAGCTGCTGGAGTCGAACCGGCAGACGCGCCTGGAATTCCAGCAACAGCTTGGGGAGGCCCCTGGCG
ATGCCAGCCCCTAGGTGCCGGGAGCCCCCATCCAGGCCCTACCCTCACCTCTCTAGGCCATGTTCTGGCC
TGGGTAGATACTACTTGGCTTAGACACCATCTCGGGTACTGGCCTCCAGATCCTAGTGGGTCTACCAGCC
T
Notes:The probe template was PCR amplified from IMAGE:2812475 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2812475 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10003 same embryo
 EMAGE:10002 same embryo
 EMAGE:10004 same embryo
 EMAGE:10001 same embryo
 EurExpress:euxassay_000206 same experiment
 MGI:4822590 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS