Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10008

Msrb3 methionine sulfoxide reductase B3 ( MGI:2443538)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10008 EMAGE:10008 EMAGE:10008 EMAGE:10008 EMAGE:10008
"Pseudo-wholemount" of euxassay_000090. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000090_01 euxassay_000090_02 euxassay_000090_03 euxassay_000090_04
EMAGE:10008 EMAGE:10008 EMAGE:10008 EMAGE:10008 EMAGE:10008
euxassay_000090_05 euxassay_000090_06 euxassay_000090_07 euxassay_000090_08 euxassay_000090_09
EMAGE:10008 EMAGE:10008 EMAGE:10008 EMAGE:10008 EMAGE:10008
euxassay_000090_10 euxassay_000090_11 euxassay_000090_12 euxassay_000090_13 euxassay_000090_14
EMAGE:10008 EMAGE:10008 EMAGE:10008 EMAGE:10008 EMAGE:10008
euxassay_000090_15 euxassay_000090_16 euxassay_000090_17 euxassay_000090_18 euxassay_000090_19
EMAGE:10008 EMAGE:10008 EMAGE:10008 EMAGE:10008
euxassay_000090_20 euxassay_000090_21 euxassay_000090_22 euxassay_000090_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10008Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10008_wholemount_strong.wlz
10008_wholemount_moderate.wlz
10008_wholemount_weak.wlz
10008_wholemount_possible.wlz
10008_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10008_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 09 moderate expression: see section 02 03 04 05 06 08 10 14 20 22
shoulder
moderate moderate
regionalmoderate expression: see section 04
hindlimb
moderate moderate
regionalmoderate expression: see section 08
leg
moderate moderate
regionalmoderate expression: see section 08
hip
moderate moderate
regionalmoderate expression: see section 08
lower leg
moderate moderate
regionalmoderate expression: see section 04
fibula
moderate moderate
regionalmoderate expression: see section 04
tibia
moderate moderate
regionalmoderate expression: see section 04
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 weak expression: see section 08
trigeminal v ganglion
strong strong
regionalstrong expression: see section 23 moderate expression: see section 06 09 17 18 22
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 09 18
inner ear
moderate moderate
regionalmoderate expression: see section 03
labyrinth
moderate moderate
regionalmoderate expression: see section 01 02 03
otic capsule
strong strong
regionalstrong expression: see section 09 moderate expression: see section 01 02 03 04 23
inner ear vestibular component
moderate moderate
regionalmoderate expression: see section 07
cochlea
moderate moderate
regionalmoderate expression: see section 04
viscerocranium
weak weak
regionalExpression in the turbinate bone.
heart
strong strong
single cellstrong expression: see section 16 moderate expression: see section 15
heart valve
weak weak
single cellweak expression: see section 17
heart ventricle
strong strong
single cellstrong expression: see section 16 moderate expression: see section 12 15
hyoid
moderate moderate
regionalmoderate expression: see section 19 20
lower jaw
moderate moderate
regionalmoderate expression: see section 08
lower jaw skeleton
moderate moderate
regionalmoderate expression: see section 10 11 15 20
mandible
strong strong
regionalstrong expression: see section 09 moderate expression: see section 08 16 17 18
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 11 12
lower jaw mesenchyme
moderate moderate
regionalmoderate expression: see section 15 16 18
upper jaw
moderate moderate
regionalmoderate expression: see section 18
upper jaw skeleton
strong strong
regionalstrong expression: see section 09 moderate expression: see section 17
maxilla
moderate moderate
regionalmoderate expression: see section 22
palatal shelf
moderate moderate
regionalmoderate expression: see section 12 15 16 17 18
premaxilla
strong strong
regionalstrong expression: see section 09 moderate expression: see section 10 16
primary palate
moderate moderate
regionalmoderate expression: see section 12 15
bladder
moderate moderate
regionalmoderate expression: see section 17
lung
strong strong
single cellstrong expression: see section 18 moderate expression: see section 12 16 weak expression: see section 17 22
skeleton
moderate moderate
regionalmoderate expression: see section 19 21
axial skeleton
moderate moderate
regionalmoderate expression: see section 14 19
lumbar vertebra
moderate moderate
regionalmoderate expression: see section 19
nucleus pulposus
moderate moderate
regionalmoderate expression: see section 17 20
axial skeleton sacral region
moderate moderate
regionalmoderate expression: see section 08
thoracic vertebra
moderate moderate
regionalmoderate expression: see section 11 15 16 17
chondrocranium
moderate moderate
regionalmoderate expression: see section 07
vault of skull
moderate moderate
regionalmoderate expression: see section 07
frontal bone primordium
moderate moderate
regionalmoderate expression: see section 01 02 03
facial bone primordium
strong strong
regionalstrong expression: see section 09 moderate expression: see section 01 02 04 07 weak expression: see section 08
clavicle
moderate moderate
regionalmoderate expression: see section 17
scapula
moderate moderate
regionalmoderate expression: see section 04
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 08
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1633
Entity Detected:Msrb3, methionine sulfoxide reductase B3 ( MGI:2443538)
Sequence:sense strand is shown

>T1633
TGGCCTCGAGCCAGATTCGGCACGAGGCAAAAATGTGCCCGAGATGAGCACCACACTGAGAACAGCTGGT
TTCCACCCTGTGCATCCCGTAGGAAAAGTCATCTGTGAACTCGATGGCCTCCGAACTGATCACATCATGG
AAGGCAGGCCAGCCTGAACCAGAGTCAAATTTGGTTTCTGACTTGAACAACGGAGTTCCACAGACAACAC
ATTTATATATTCCAGGATCTTTGTGATGTGTGTACTCTCCTTCAAAGGCACTTTCAGTTCCTTTCTCCTG
AGTGACATGGTACTGTAGGGGTGTCAGCCGCTTCCTCAGTTCCTGCTGGGAAAAGACCACCTTACAGTTC
TTTTTATCCCTACATGACCCTGAGGGGAGCCCGCAGGCTCTCGGGGCCACGGGCTGGCTCTTCGTCACCA
AGTGCAGCAGGTTGAAGGCAGACATAGCTGTGGTATCTCCAGCAGAGGCAAAGGCAGCGGCAGAAGCGCG
CGTCGTGGTGGCC
Notes:The probe template was PCR amplified from IMAGE:445279 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:445279 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:NMRI
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10007 same embryo
 EMAGE:10006 same embryo
 EurExpress:euxassay_000090 same experiment
 MGI:4826471 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS