EMAGE mouse gene expression spatial database

EMAGE:10073

Eed embryonic ectoderm development ( MGI:95286)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_017307. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_017307_01	euxassay_017307_02	euxassay_017307_03	euxassay_017307_04

euxassay_017307_05	euxassay_017307_06	euxassay_017307_07	euxassay_017307_08	euxassay_017307_09

euxassay_017307_10	euxassay_017307_11	euxassay_017307_12	euxassay_017307_13	euxassay_017307_14

euxassay_017307_15	euxassay_017307_16	euxassay_017307_17	euxassay_017307_18	euxassay_017307_19

euxassay_017307_20	euxassay_017307_21	euxassay_017307_22	euxassay_017307_23	euxassay_017307_24

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Annotation Validation:

spatial mapping by EMAGE editor

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T1502
Entity Detected:	Eed, embryonic ectoderm development ( MGI:95286)
Sequence:	sense strand is shown >T1502 TTTTTTTTTTTTTTACAAAAATAAATTTTTATTAAAAGCAGTAAAGTCCGAGCAGGAAGACAGTACAAAG AATGTAAACAATGTGAACATCACTACATTCAGCTCAGCCTGATCGAATGCTGAAAAACAAGTCTAAATGC TCTATGTGCCCTTACTAGCAAGATACATTACTTCTATTTTACAGACAACAGACTAATTTTTACTAGGAAA AAATAGTTTATCGAAGTCGATCCCATCGCCAAATGCTGGCATCATCGCAGACAGCTATGAGGATGCTGCT ATCCCTACTGAAACTGGTTTGTCGAATAGCCGCGCCACATTTATGATGGGTCAGTGTTGTGCATTTGGCT TTATGAGGATCTTCTACTTCTAAATCCCAAACATACAGTTTGCCAACCTGATTGCCCAATGCAAGCATCT TTTGCCAGAAATCCATAGAAAACCTCATGTACCAAATGTCACACTGGCTGTAATCAAATCGCCCAAGA
Notes:	The probe template was PCR amplified from IMAGE:540416 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:540416 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10074 same embryo
	EurExpress:euxassay_017307 same experiment
	EMAGE:31388 same embryo
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source