Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10110

Cep68 centrosomal protein 68 ( MGI:2667663)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110
"Pseudo-wholemount" of euxassay_000074. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000074_01 euxassay_000074_02 euxassay_000074_03 euxassay_000074_04
EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110
euxassay_000074_05 euxassay_000074_06 euxassay_000074_07 euxassay_000074_08 euxassay_000074_09
EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110
euxassay_000074_10 euxassay_000074_11 euxassay_000074_12 euxassay_000074_13 euxassay_000074_14
EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110
euxassay_000074_15 euxassay_000074_16 euxassay_000074_17 euxassay_000074_18 euxassay_000074_19
EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110 EMAGE:10110
euxassay_000074_20 euxassay_000074_21 euxassay_000074_22 euxassay_000074_23 euxassay_000074_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10110Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10110_wholemount_strong.wlz
10110_wholemount_moderate.wlz
10110_wholemount_weak.wlz
10110_wholemount_possible.wlz
10110_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10110_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 13 14 17 18 weak expression: see section 15 16
submandibular gland primordium
strong strong
regionalstrong expression: see section 09 10 11 12 19 20 21 22 moderate expression: see section 08
vibrissa
weak weak
regionalweak expression: see section 06 07 08 21 22
telencephalon ventricular layer
weak weak
homogeneousweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 05 06 weak expression: see section 07 08 23
glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 21
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 05 06 weak expression: see section 07 08 09 10 19 20 21 22 23 24
lower jaw incisor
weak weak
regionalweak expression: see section 12 13 14 17 18
upper jaw incisor
weak weak
regionalweak expression: see section 12 13 14 16 17
renal cortex
weak weak
regionalweak expression: see section 09 10 11 12 13 19 20 21 22 23 24
testis
weak weak
regionalweak expression: see section 07 08 09 10 22 23 24
lung
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
tail dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 18 21 weak expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1517
Entity Detected:Cep68, centrosomal protein 68 ( MGI:2667663)
Sequence:sense strand is shown

>T1517
TCCCTCCTTTCAGGCAGAATACTGGGCCTGTGCGCTGCCAAATTCTCTGCCTCCTTCCCCTAACCGCCAC
TCCGCACTCTGGGACCCAAATAAAGAGTATGAAGATCTGCTTGACTACACTTACCCACTGAGGCCTGGGC
CTCAGCTCCCAAAGCAACCTGAAAGTCATGTCCTGACTGAGCCTGTTCTGCAGGACTCAGGTGTAGATCT
GGACAGTTTGTCTGTCTCCCCAGCAAGTACTCTAAAGTCACCCACTAATGTCTCCCACAATTGCTCATCA
GCAGAAGTGCCTACTCTGCCATTTTCTGGAGCCAGAGAGTCATGTCTTAAGCGCTGGCCCTTGGGAATAT
TCCAGAAACAGGGTGGCACAAGCTTGTCATCCTGGAACCAGCTTGCATCAACCCCTAGAGCCCCAGGCAC
TGAAGATGCTTCTTGGGAGAACAGAGAGGCAGCCCTGAGGGGCACAGCGGAGGACTGCCTCCCTATAGGT
GAGGACCTCCGAATGGGCTCTCCCCAGCTG
Notes:The probe template was PCR amplified from IMAGE:790035 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:790035 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10111 same embryo
 EMAGE:10109 same embryo
 EMAGE:10108 same embryo
 EurExpress:euxassay_000074 same experiment
 MGI:4823818 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS