Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10135

Atp1b1 ATPase, Na+/K+ transporting, beta 1 polypeptide ( MGI:88108)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135
"Pseudo-wholemount" of euxassay_000015. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000015_01 euxassay_000015_02 euxassay_000015_03 euxassay_000015_04
EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135
euxassay_000015_05 euxassay_000015_06 euxassay_000015_07 euxassay_000015_08 euxassay_000015_09
EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135
euxassay_000015_10 euxassay_000015_11 euxassay_000015_12 euxassay_000015_13 euxassay_000015_14
EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135
euxassay_000015_15 euxassay_000015_16 euxassay_000015_17 euxassay_000015_18 euxassay_000015_19
EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135 EMAGE:10135
euxassay_000015_20 euxassay_000015_21 euxassay_000015_22 euxassay_000015_23 euxassay_000015_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10135Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10135_wholemount_strong.wlz
10135_wholemount_moderate.wlz
10135_wholemount_weak.wlz
10135_wholemount_possible.wlz
10135_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10135_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pericardium
strong strong
homogeneousstrong expression: see section 24 moderate expression: see section 22
medulla oblongata part of 4th ventricle choroid plexus
strong strong
regionalstrong expression: see section 04 14 18
visceral organ system
strong strong
regionalstrong expression: see section 06
pancreas
strong strong
homogeneousstrong expression: see section 10 11 12 13 19 moderate expression: see section 17
body of pancreas
strong strong
spottedstrong expression: see section 10 11 12 13
head of pancreas
strong strong
spottedstrong expression: see section 10 11 12 13
tail of pancreas
strong strong
spottedstrong expression: see section 13 19
forebrain
strong strong
single cellstrong expression: see section 12
pituitary gland
strong strong
single cellstrong expression: see section 10 11 12 moderate expression: see section 15
adenohypophysis
strong strong
single cellstrong expression: see section 12 13
adenohypophysis pars anterior
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16
adenohypophysis pars intermedia
moderate moderate
homogeneousmoderate expression: see section 13 14
adenohypophysis pars tuberalis
moderate moderate
homogeneousmoderate expression: see section 13 14
neurohypophysis
strong strong
single cellstrong expression: see section 10 12 13 moderate expression: see section 15
neurohypophysis infundibulum
strong strong
regionalstrong expression: see section 13 moderate expression: see section 14 15 16
median eminence
moderate moderate
regionalmoderate expression: see section 15 16
neurohypophysis
moderate moderate
regionalmoderate expression: see section 13 15 16
physiological umbilical hernia
strong strong
regionalstrong expression: see section 11 12 14 18 19
diencephalic part of interventricular foramen
moderate moderate
regionalmoderate expression: see section 13
epithalamus
weak weak
regionalweak expression: see section 12
epithalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14
3rd ventricle choroid plexus
strong strong
regionalstrong expression: see section 14 moderate expression: see section 13
hypothalamus
moderate moderate
regionalmoderate expression: see section 11
hypothalamus mantle layer
weak weak
regionalweak expression: see section 12
hypothalamus marginal layer
weak weak
regionalweak expression: see section 12
hypothalamus ventricular layer
moderate moderate
homogeneousmoderate expression: see section 13 14 weak expression: see section 12 15 16
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 13 14 weak expression: see section 12 15 16
thalamus
weak weak
regionalweak expression: see section 10
thalamus mantle layer
weak weak
regionalweak expression: see section 12
thalamus ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 13 14 weak expression: see section 15 16
telencephalon
strong strong
single cellstrong expression: see section 12 21
cerebral cortex
strong strong
homogeneousstrong expression: see section 02 03 04 07 12 14 18 21 moderate expression: see section 06 10 weak expression: see section 05 08
cerebral cortex mantle layer
strong strong
homogeneousstrong expression: see section 01 12 13 14 18 moderate expression: see section 15 16
cerebral cortex marginal layer
strong strong
homogeneousstrong expression: see section 11 12 13 14 18 moderate expression: see section 15 16
cerebral cortex ventricular layer
strong strong
spottedstrong expression: see section 21
lateral ventricle choroid plexus
strong strong
homogeneousstrong expression: see section 11 12
corpus striatum
weak weak
regionalweak expression: see section 04 07 08
hindbrain
moderate moderate
regionalmoderate expression: see section 10
medulla oblongata
strong strong
regionalstrong expression: see section 06 07
medulla oblongata lateral wall
strong strong
spottedstrong expression: see section 21
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13 14 15 16
medulla oblongata alar plate marginal layer
moderate moderate
regionalmoderate expression: see section 14 15 16
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 10 11 13 14 15 16
medulla oblongata basal plate marginal layer
moderate moderate
regionalmoderate expression: see section 14 15 16
cerebellum
strong strong
regionalstrong expression: see section 02 03 04 12 13 21 22 moderate expression: see section 08 10 14 weak expression: see section 06 07
cerebellum intraventricular portion
strong strong
homogeneousstrong expression: see section 18
rest of cerebellum mantle layer
strong strong
homogeneousstrong expression: see section 12 13 14 15 16 moderate expression: see section 11
rest of cerebellum marginal layer
strong strong
homogeneousstrong expression: see section 12 13 14 15 16
metencephalon rest of alar plate
strong strong
homogeneousstrong expression: see section 18
metencephalon basal plate
strong strong
regionalstrong expression: see section 06 07 moderate expression: see section 08 10
pons
strong strong
regionalstrong expression: see section 07 12
pons mantle layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13 14 15 16
pons marginal layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13 14 15 16
metencephalon part of 4th ventricle choroid plexus
strong strong
homogeneousstrong expression: see section 11 12 13 14
midbrain
strong strong
regionalstrong expression: see section 04 06 07 not examined expression: see section 10
midbrain mantle layer
strong strong
regionalstrong expression: see section 10 11 12 13 14 moderate expression: see section 15 16
midbrain marginal layer
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 15 16
tegmentum
strong strong
regionalstrong expression: see section 12 moderate expression: see section 11 14 weak expression: see section 10
central nervous system ganglion
moderate moderate
spottedmoderate expression: see section 07
facial vii ganglion
strong strong
homogeneousstrong expression: see section 04 07 08
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 07 08
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 18 19 22 23
vagus x ganglion
strong strong
homogeneousstrong expression: see section 06 07 08 18 19
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 07 08 18
spinal cord lateral wall
strong strong
regionalstrong expression: see section 14
spinal cord mantle layer
strong strong
homogeneousstrong expression: see section 13 14 moderate expression: see section 10
alar columns
moderate moderate
homogeneousmoderate expression: see section 11 12 15 16
basal columns
moderate moderate
homogeneousmoderate expression: see section 11 12 15 16
spinal cord marginal layer
strong strong
homogeneousstrong expression: see section 13 14
spinal cord sulcus limitans
strong strong
regionalstrong expression: see section 14
autonomic nervous system
moderate moderate
homogeneousmoderate expression: see section 08
hypogastric plexus
strong strong
homogeneousstrong expression: see section 13
sympathetic nervous system
strong strong
homogeneousstrong expression: see section 11
sympathetic ganglion
strong strong
homogeneousstrong expression: see section 11
thoracic ganglion
strong strong
homogeneousstrong expression: see section 12 14
spinal ganglion
strong strong
homogeneousstrong expression: see section 08
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 11 14 16 17 18
nasal cavity olfactory epithelium
strong strong
homogeneousstrong expression: see section 11 moderate expression: see section 10 14 15 not examined expression: see section 12
nasal cavity respiratory epithelium
strong strong
homogeneousstrong expression: see section 11 moderate expression: see section 10 14 15 not examined expression: see section 12
nasal septum
weak weak
regionalweak expression: see section 13
nasal septum epithelium
weak weak
homogeneousweak expression: see section 13
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
heart
strong strong
homogeneousstrong expression: see section 13 24 moderate expression: see section 08 10 11 12 17 22 weak expression: see section 09
heart atrium
strong strong
homogeneousstrong expression: see section 12 13 14 15 16 20 moderate expression: see section 11 17 18 19
endocardial cushion tissue
strong strong
regionalstrong expression: see section 14
endocardial tissue
strong strong
regionalstrong expression: see section 14
interventricular groove
moderate moderate
homogeneousmoderate expression: see section 13
left ventricle cardiac muscle
moderate moderate
homogeneousmoderate expression: see section 14 15 16 17 18 19 not examined expression: see section 11 12
right ventricle cardiac muscle
moderate moderate
homogeneousmoderate expression: see section 10 11 12
foregut duodenum
strong strong
homogeneousstrong expression: see section 14
duodenum rostral part
strong strong
homogeneousstrong expression: see section 14
duodenum rostral part epithelium
strong strong
homogeneousstrong expression: see section 13 14 15
gastro-esophageal junction
strong strong
homogeneousstrong expression: see section 14
gastro-esophageal junction epithelium
strong strong
homogeneousstrong expression: see section 14 15
stomach
strong strong
homogeneousstrong expression: see section 06 moderate expression: see section 03
stomach fundus
strong strong
regionalstrong expression: see section 06
stomach pyloric region
strong strong
regionalstrong expression: see section 06 07 08
stomach pyloric region epithelium
strong strong
homogeneousstrong expression: see section 10 11 12
pyloric antrum
strong strong
regionalstrong expression: see section 12
not examined not examined
regionalnot examined expression: see section 06 07 08 10 11
perineal body epithelium
strong strong
homogeneousstrong expression: see section 15
rectum epithelium
strong strong
homogeneousstrong expression: see section 15
midgut
strong strong
homogeneousstrong expression: see section 15
duodenum caudal part epithelium
strong strong
homogeneousstrong expression: see section 15
jejunum epithelium
strong strong
homogeneousstrong expression: see section 15
metanephros
strong strong
spottedstrong expression: see section 11 19 20 22 moderate expression: see section 23 weak expression: see section 09
kidney calyx
strong strong
spottedstrong expression: see section 11 moderate expression: see section 07
collecting duct
strong strong
spottedstrong expression: see section 10 moderate expression: see section 07
metanephros
strong strong
spottedstrong expression: see section 20 21 22
renal cortex
strong strong
spottedstrong expression: see section 08 11
medullary renal tubule
moderate moderate
spottedmoderate expression: see section 07
testis
strong strong
spottedstrong expression: see section 07 08 moderate expression: see section 24
testis
not examined not examined
spottednot examined expression: see section 10 11
respiratory system
strong strong
spottedstrong expression: see section 19
laryngeal cartilage
strong strong
regionalstrong expression: see section 14
lung
strong strong
spottedstrong expression: see section 05 07 08 10 19 moderate expression: see section 12 14 18 22 23 24 weak expression: see section 11 21
respiratory tract
moderate moderate
regionalmoderate expression: see section 14
lower respiratory tract
moderate moderate
regionalmoderate expression: see section 14
upper respiratory tract
moderate moderate
regionalmoderate expression: see section 14 15
not examined not examined
homogeneousnot examined expression: see section 14
stomach fundus lumen
strong strong
regionalstrong expression: see section 06
stomach proventricular region lumen
strong strong
regionalstrong expression: see section 06 09
stomach pyloric region lumen
strong strong
regionalstrong expression: see section 06 09 12
foregut-midgut junction lumen
strong strong
regionalstrong expression: see section 09 18
perineal body lumen
strong strong
homogeneousstrong expression: see section 20
rectum lumen
strong strong
regionalstrong expression: see section 18 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1781
Entity Detected:Atp1b1, ATPase, Na+/K+ transporting, beta 1 polypeptide ( MGI:88108)
Sequence:sense strand is shown

>T1781
TGGCCTCGAGGCCAGATTCGGATCCATGCTTGTAGTGAGCAGTGTTCTGGCCCCTAAGTATTGCCGCCTT
GTCTATTTTATTTAGTGTACAGTACTATAGGTGCGCACTCTGGTCATTTTTCAAGCCATGTTTTATCATA
TCTGTTTTCTACTTTACGTGAGCAAGGTTTGCTGTCCAAGGTGTAAATACTCAACGGGAATAAAACTGGC
ATGGTACTTTTTCCTTTCTTTCTTATTTTCTTGGCTCTGAAATTTCAAAGGTAACGGCCCATCGATGAGC
ATTTTTAACACACTCCATAGTCTCTTCCTGTGGTATCAGGTCTTTATTATTATTTTTTTTTTTTCTTTAT
TTCCTGGGGCTGGGGGGTGGGCTGTCATGGGGGAACTGCCCTTTAAATTTTAAGTGACAGTACAGAAAAA
TCA
Notes:The probe template was PCR amplified from IMAGE:571882 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:571882 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10136 same embryo
 EMAGE:10139 same embryo
 EMAGE:10137 same embryo
 EMAGE:10138 same embryo
 EurExpress:euxassay_000015 same experiment
 MGI:4823306 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS