Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10139

Nsg2 neuron specific gene family member 2 ( MGI:1202070)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139
"Pseudo-wholemount" of euxassay_000024. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000024_01 euxassay_000024_02 euxassay_000024_03 euxassay_000024_04
EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139
euxassay_000024_05 euxassay_000024_06 euxassay_000024_07 euxassay_000024_08 euxassay_000024_09
EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139
euxassay_000024_10 euxassay_000024_11 euxassay_000024_12 euxassay_000024_13 euxassay_000024_14
EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139
euxassay_000024_15 euxassay_000024_16 euxassay_000024_17 euxassay_000024_18 euxassay_000024_19
EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139 EMAGE:10139
euxassay_000024_20 euxassay_000024_21 euxassay_000024_22 euxassay_000024_23 euxassay_000024_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10139Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10139_wholemount_strong.wlz
10139_wholemount_moderate.wlz
10139_wholemount_weak.wlz
10139_wholemount_possible.wlz
10139_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10139_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
tail vertebral pre-cartilage condensation
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 18
limb
weak weak
regionalweak expression: see section 03
visceral organ system
moderate moderate
homogeneousmoderate expression: see section 15
central nervous system
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 24
peripheral nervous system
strong strong
homogeneousstrong expression: see section 08 10 11 12 13 15 16 17 18 19 20 21 22 24 moderate expression: see section 01 02 03 04 05 06 07 09
retina
strong strong
homogeneousstrong expression: see section 03 04 moderate expression: see section 01 02
nasal cavity olfactory epithelium
weak weak
homogeneousweak expression: see section 14
vomeronasal organ epithelium
weak weak
homogeneousweak expression: see section 14
axial skeleton
moderate moderate
regionalmoderate expression: see section 15 16 weak expression: see section 14 17
tail vertebral cartilage condensation
strong strong
regionalstrong expression: see section 16 17 moderate expression: see section 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1755
Entity Detected:Nsg2, neuron specific gene family member 2 ( MGI:1202070)
Sequence:sense strand is shown

>T1755
TGGCCTCGAGNCAGATTCGGCACGAGGCCGGGTTTTGCTTTTTCCCCAAAGCGCTAATGACAGCAGGAAT
GACAATTGAATTCTAGTTAGTTGAAATCTGACAGCCGGGAAGAAACTTGAAGATTGGGCAGGCAGTGCTC
ATTCCTAAAAGAAGCTGGAGAAGGTGACTGTTTGCTCACTGTGTTGTGTTGACAGAGTTGTCCAGACTTC
CCAGCTAGGTTCTAGAAGCACCTGACAGGGAGGTGTGGCCAACATCCTTAGGCTTCTCACTGGCACTTTA
GCAAGGGCCTCCTGCTTCTCGCGAGCATTCCAGGAAATCCCTTTTCTTGGAGGTGCTGGCCCCAGGTCCA
AGAGAATGAGAACTGGCCAGGGGAATTGCCCATTTGGTCTGCATAGGCCGTTTAAGGGTATTTTTTTGTG
GCTTGCTATATTGCTGAAATTATTGTACACAGCAGCTGGGTAATAGGAATAGTATATCTCAAACCATCCT
GCCAGATACTCTCATCTGATTTCTCCTCCCTCCCCCCATCTTCCCATCACCTTGAGTCACCTGTAAATT
Notes:The probe template was PCR amplified from IMAGE:482989 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:482989 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10135 same embryo
 EMAGE:10136 same embryo
 EMAGE:10137 same embryo
 EMAGE:10138 same embryo
 EurExpress:euxassay_000024 same experiment
 MGI:4826805 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS