Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:1016

Pax3 paired box gene 3 ( MGI:97487)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:1016 EMAGE:1016 EMAGE:1016 EMAGE:1016
Fig 3a of Kwang et al., 2002 [PMID:11807043] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Fig 3d of Kwang et al., 2002 [PMID:11807043] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Fig 3g of Kwang et al., 2002 [PMID:11807043] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Fig 3j of Kwang et al., 2002 [PMID:11807043] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: no stars
Notes:
The embryo shown in Figs A and D was section to produce section G and J at the levels indicated. Image annotations: r5 - rhombomere 5; o - otic vesicle.
Expression Pattern Description
Text Annotation:
StructureLevelPatternNotes
future hindbrain
strong strong
regionalHigher levels of expression caudal of the otic region. Expression was dorsally and laterally.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1101193
Entity Detected:Pax3, paired box gene 3 ( MGI:97487)
Sequence:sense strand is shown

>MGI:1101193
AAGCTTACCGAGGCCCGAGTGCAGGTCTGGTTTAGCAACCGCCGTGCAAGATGGAGGAAACAAGCTGGAG
CCAATCAACTGATGGCTTTCAACCATCTCATTCCGGGGGGATTCCCTCCCACCGCCATGCCGACCCTGCC
AACATACCAGCTGTCGGAGACCTCTTACCAGCCCACGTCTATTCCACAAGCCGTGTCAGATCCCAGTAGC
ACCGTCCACAGACCTCAGCCGCTTCCTCCGAGCACTGTACACCAAAGCACTATTCCTTCGAACGCAGACA
GCAGCTCTGCCTACTGCCTCCCCAGCACCAGGCATGGATTTTCAAGCTATACAGACAGCTTTGTGCCTCC
ATCGGGGCCCTCCAACCCCATGAACCCCACCATCGGCAATGGCCTTTCACCTCAGGTAATGGGACTTCTG
ACCAACCACGGTGGGGTACCGCACCAGCCTCAGACCGACTATGCTCTCTCCCCTCTCACTGGGGGCCTGG
AACCCACGACCACGGTGTCAGCCAGCTGCA
nt 1157 - nt 1676 of NM_008781.2
Notes:The Pax3 probe used in this study by Kwang et al., 2002 [PMID:11807043] is described as "a 530 bp HindIII-PstI fragment of the murine Pax3 cDNA (Goulding et al., 1991 [PMID:2022185] )
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:sectioned wholemount
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
Staining procedure:alkaline phosphatase + undefined
General Information
Authors:Kwang et al., 2002 [PMID:11807043] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:11807043] Kwang SJ, Brugger SM, Lazik A, Merrill AE, Wu LY, Liu YH, Ishii M, Sangiorgi FO, Rauchman M, Sucov HM, Maas RL, Maxson RE 2002 Msx2 is an immediate downstream effector of Pax3 in the development of the murine cardiac neural crest. Development (129):527-38
 [ PMID:2022185] Goulding MD, Chalepakis G, Deutsch U, Erselius JR, Gruss P 1991 Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J (10):1135-47
Links:MGI:2177927 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI