Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10169

Pde10a phosphodiesterase 10A ( MGI:1345143)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169
"Pseudo-wholemount" of euxassay_000057. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000057_01 euxassay_000057_02 euxassay_000057_03 euxassay_000057_04
EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169
euxassay_000057_05 euxassay_000057_06 euxassay_000057_07 euxassay_000057_08 euxassay_000057_09
EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169
euxassay_000057_10 euxassay_000057_11 euxassay_000057_12 euxassay_000057_13 euxassay_000057_14
EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169
euxassay_000057_15 euxassay_000057_16 euxassay_000057_17 euxassay_000057_18 euxassay_000057_19
EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169 EMAGE:10169
euxassay_000057_20 euxassay_000057_21 euxassay_000057_22 euxassay_000057_23 euxassay_000057_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10169Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10169_wholemount_strong.wlz
10169_wholemount_moderate.wlz
10169_wholemount_weak.wlz
10169_wholemount_possible.wlz
10169_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10169_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
epithalamus
moderate moderate
regionalmoderate expression: see section 14
diencephalon floor plate
moderate moderate
regionalmoderate expression: see section 14 15
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 16 17 18
diencephalon lateral wall
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 14 15
thalamus
strong strong
regionalstrong expression: see section 10 11 12 16 17 18 19 moderate expression: see section 13
telencephalon
strong strong
regionalstrong expression: see section 05 06 07 08 23 24 moderate expression: see section 09 10 11 12 14 15 17 18 19 20 21 22
cerebral cortex
strong strong
regionalstrong expression: see section 03 04 moderate expression: see section 01 02
medulla oblongata floor plate
moderate moderate
regionalmoderate expression: see section 14 15
medulla oblongata lateral wall
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17 18 19 20
metencephalon lateral wall
strong strong
regionalstrong expression: see section 08 moderate expression: see section 09 10 11 12 13 16 17 18 19 22
metencephalon alar plate
moderate moderate
regionalmoderate expression: see section 20 21
cerebellum
moderate moderate
regionalmoderate expression: see section 06 07
metencephalon basal plate
moderate moderate
regionalmoderate expression: see section 14 15
pons
strong strong
regionalstrong expression: see section 10 11 17 18 19
midbrain floor plate
moderate moderate
regionalmoderate expression: see section 14 15
midbrain lateral wall
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 16 17 18 19 20 21
midbrain roof plate
moderate moderate
regionalmoderate expression: see section 12 13 14 15
tegmentum
moderate moderate
regionalmoderate expression: see section 14 15
facial vii ganglion
strong strong
homogeneousstrong expression: see section 10 not examined expression: see section 08 09 20
glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 09 20
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 08 09 19 20 21 22 23 24
vagus x ganglion
strong strong
homogeneousstrong expression: see section 09 10 19 20 21
vestibulocochlear viii ganglion
strong strong
homogeneousstrong expression: see section 08 09 19 20 21
spinal cord
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 09 10 11 12 18 19 20 moderate expression: see section 13
neural retina
strong strong
homogeneousstrong expression: see section 24 moderate expression: see section 01 03 04 weak expression: see section 02
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1510
Entity Detected:Pde10a, phosphodiesterase 10A ( MGI:1345143)
Sequence:sense strand is shown

>T1510
TCCCAAAAGCCGACGGATTTGCACTGTACTTCCTTGGAGAGTGCAATAATAGCCTGTGTGTGTTCATACC
ACCCGGGATGAAGGAAGGCCAACCCCGGCTCATCCCTGCGGGGCCCATCACCCAGGGTACCACCATCTCT
GCCTACGTGGCCAAGTCTAGGAAGACGTTGTTGGTAGAGGATATCCTTGGGGATGAGCGATTTCCTCGAG
GTACTGGCCTGGAATCAGGAACCCGCATCCAGTCTGTTCTTTGCTTGCCCATTGTCACTGCCATTGGAGA
CTTGATTGGCATCCTTGAACTGTACAGGCACTGGGACAAAGAGGCCTTCTGCCTCAGCCATCAGGAGGTT
GCAACAGCCAATCTTGCTTGGGCTTCCGTAGCAATACACCAGGTGCAGGTGTGTAGAGGTCTCGCCAAAC
AGACCGAACTGAATGACTTCCTACTCGACGTATCAAAGACATACTTTGATAACATAGTTGCCATAGACTC
TCTACTTGAACACATCATAATATATGC
Notes:The probe template was PCR amplified from IMAGE:760844 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:760844 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4827116 same experiment
 EurExpress:euxassay_000057 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS