Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:1017

Pax3 paired box gene 3 ( MGI:97487)
TS15 (9.5 dpc)
in situ hybridisation

Data Images
EMAGE:1017 EMAGE:1017
Figure 1A of Houzelstein et al., 1999 [PMID:10331980] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 1B of Houzelstein et al., 1999 [PMID:10331980] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Only the data from image A has been spatially mapped in this EMAGE entry whereas text annotation is for both images. Image annotations: (A) arrowhead - muscle progenitor cells that have left somites 9-12 at the level of the forelimb bud. (B) arrowhead - cells that have left occipital somites 4-7, and which will subsequently contribute to tongue and hypoglossal muscles; 9 - somite 9; 13 - somite 13, fl- forelimb bud.
Expression Pattern Description
Spatial Annotation:
EMAGE:1017Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
1017_wholemount_strong_3D_1.wlz
1017_wholemount_moderate_3D_1.wlz
1017_wholemount_weak_3D_1.wlz
1017_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:1017_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
trunk somite
detected detected
regionalExpression is seen in muscle progenitor cells that have left somites 9-12 at the level of the forelimb bud.
forelimb bud
detected detected
regionalPositive cells are dermomyotomal cells that are located in the proximal part of the forelimb, adjacent to somites 9-14
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1101193
Entity Detected:Pax3, paired box gene 3 ( MGI:97487)
Sequence:sense strand is shown

>MGI:1101193
AAGCTTACCGAGGCCCGAGTGCAGGTCTGGTTTAGCAACCGCCGTGCAAGATGGAGGAAACAAGCTGGAG
CCAATCAACTGATGGCTTTCAACCATCTCATTCCGGGGGGATTCCCTCCCACCGCCATGCCGACCCTGCC
AACATACCAGCTGTCGGAGACCTCTTACCAGCCCACGTCTATTCCACAAGCCGTGTCAGATCCCAGTAGC
ACCGTCCACAGACCTCAGCCGCTTCCTCCGAGCACTGTACACCAAAGCACTATTCCTTCGAACGCAGACA
GCAGCTCTGCCTACTGCCTCCCCAGCACCAGGCATGGATTTTCAAGCTATACAGACAGCTTTGTGCCTCC
ATCGGGGCCCTCCAACCCCATGAACCCCACCATCGGCAATGGCCTTTCACCTCAGGTAATGGGACTTCTG
ACCAACCACGGTGGGGTACCGCACCAGCCTCAGACCGACTATGCTCTCTCCCCTCTCACTGGGGGCCTGG
AACCCACGACCACGGTGTCAGCCAGCTGCA
nt 1157 - nt 1676 of NM_008781.2
Notes:The Pax3 (Goulding et al., 1991 [PMID:2022185] ) probe used in this study by Houzelstein et al., 1999 [PMID:10331980] is described as "a 519 bp PstI-HindIII fragment from the 3' coding end of the mouse cDNA (kindly provided by P Gruss)."
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Age:9.5 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Staining procedure:alkaline phosphatase + BMpurple
General Information
Authors:Houzelstein et al., 1999 [PMID:10331980] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10331980] Houzelstein D, Auda-Boucher G, Cheraud Y, Rouaud T, Blanc I, Tajbakhsh S, Buckingham ME, Fontaine-Perus J, Robert B 1999 The homeobox gene Msx1 is expressed in a subset of somites, and in muscle progenitor cells migrating into the forelimb. Development (126):2689-701
 [ PMID:2022185] Goulding MD, Chalepakis G, Deutsch U, Erselius JR, Gruss P 1991 Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J (10):1135-47
Links:MGI:1336739 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI