Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10198

Pgk1-rs7 phosphoglycerate kinase-1, related sequence-7 ( MGI:97562)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198
"Pseudo-wholemount" of euxassay_000011. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000011_01 euxassay_000011_02 euxassay_000011_03 euxassay_000011_04
EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198
euxassay_000011_05 euxassay_000011_06 euxassay_000011_07 euxassay_000011_08 euxassay_000011_09
EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198
euxassay_000011_10 euxassay_000011_11 euxassay_000011_12 euxassay_000011_13 euxassay_000011_14
EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198
euxassay_000011_15 euxassay_000011_16 euxassay_000011_17 euxassay_000011_18 euxassay_000011_19
EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198 EMAGE:10198
euxassay_000011_20 euxassay_000011_21 euxassay_000011_22 euxassay_000011_23 euxassay_000011_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10198Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10198_wholemount_strong.wlz
10198_wholemount_moderate.wlz
10198_wholemount_weak.wlz
10198_wholemount_possible.wlz
10198_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10198_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diaphragm
strong strong
regionalstrong expression: see section 04 06
vertebral axis musculature
strong strong
regionalstrong expression: see section 03 04 06 20 moderate expression: see section 02 05 07 24 weak expression: see section 01 12 17
thymus primordium
weak weak
regionalweak expression: see section 14 15 16 18
salivary gland
strong strong
homogeneousstrong expression: see section 11
submandibular gland primordium
strong strong
regionalstrong expression: see section 10 11 12 20 moderate expression: see section 08 22 23
physiological umbilical hernia
strong strong
regionalstrong expression: see section 15 18 20 moderate expression: see section 17 19 22
vibrissa
strong strong
regionalstrong expression: see section 11 moderate expression: see section 06 07 08 10 23 24
cerebral cortex
strong strong
regionalstrong expression: see section 12 moderate expression: see section 11
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 18 20 moderate expression: see section 19 22 23
cerebral cortex marginal layer
moderate moderate
gradedmoderate expression: see section 17
cerebral cortex ventricular layer
strong strong
regionalstrong expression: see section 02 03 04 06 10 12 18 20 moderate expression: see section 05 07 08 11 17 19 22 23 24 weak expression: see section 13
facial vii ganglion
strong strong
regionalstrong expression: see section 12 18 moderate expression: see section 11
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 10 11 20 moderate expression: see section 06 07 08 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07
vestibulocochlear viii ganglion
moderate moderate
regionalmoderate expression: see section 06 07
peripheral nervous system
moderate moderate
homogeneousmoderate expression: see section 12
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 11 12 13 20 22 weak expression: see section 14
nasal cavity
moderate moderate
regionalmoderate expression: see section 06 14
nasal septum
moderate moderate
regionalmoderate expression: see section 15
viscerocranium
strong strong
regionalExpression in the turbinate bone.
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 15
heart
strong strong
regionalstrong expression: see section 11 12 13 18 20 moderate expression: see section 14 15 19 weak expression: see section 16 17
stomach
strong strong
regionalstrong expression: see section 10
mandible
strong strong
regionalstrong expression: see section 20 moderate expression: see section 08 10 12
lower jaw tooth
moderate moderate
regionalmoderate expression: see section 14
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 14 18 19
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 14 18 19
urinary system
moderate moderate
regionalmoderate expression: see section 11
metanephros
moderate moderate
regionalmoderate expression: see section 11 12
lung
moderate moderate
spottedmoderate expression: see section 07 08 10 12 weak expression: see section 23
nucleus pulposus
strong strong
homogeneousstrong expression: see section 14 15 16 17 18
clavicle
strong strong
regionalstrong expression: see section 12 20 moderate expression: see section 13
tail mesenchyme
weak weak
homogeneousweak expression: see section 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1474
Entity Detected:Pgk1-rs7, phosphoglycerate kinase-1, related sequence-7 ( MGI:97562)
Sequence:sense strand is shown

>T1474
TCCTCNAGCCTGTTGGCCTACTGGAACTCTTCCTCATCTCCGGGCCTTTCGACCTCACGGTGTTGCCAAA
ATGTCGCTTTCCAACAAGCTGACTTTGGACAAGCTGGACGTGAAGGGGAAGCGGGTCGTGATGAGGGTGG
ACTTCAACGTTCCTATGAAGAACAACCAGATAACAAACAACCAAAGGATCAAGGCTGCTGTTCCAAGCAT
CAAATTCTGCTTGGACAATGGAGCCAAGTCCGTTGTCCTTATGAGCCACCTGGGCCGGCCTGATGGTGTT
CCCATGCCTGACAAGTACTCCTTAGAGCCAGTTGCTGCTGAACTCAAATCTCTGCTGGGCAAGGATGTTC
TGTTCTTGAAGGATTGTGTGGGCCCAGAAGTCGAGAATGCCTGTGCCAACCCAGCGGCTGGGACTGTCAT
CCTGCTGGAAAGCCTCCGCTTTCATGTAGAGGAAGAAGGGAAGGGAAAAGATGCTTCTGGAAACAAGGTT
AAAGCTGAGCCGGCCAAAATTGATGCTTTCCGAGCCTCACTGTCCAAACTAGGAGATGTCTATGTCAATG
AT
Notes:The probe template was PCR amplified from IMAGE:2537127 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2537127 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10199 same assay
 EMAGE:10196 same embryo
 EMAGE:10202 same embryo
 EMAGE:10200 same embryo
 EMAGE:10201 same embryo
 EurExpress:euxassay_000011 same experiment
 MGI:4827172 same experiment
 EMAGE:10197 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS