Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:1020

Pax3 paired box gene 3 ( MGI:97487)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:1020 EMAGE:1020
Figure 7A of Conway et al., 1997 [PMID:9053326] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 7C of Conway et al., 1997 [PMID:9053326] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: one star
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Figure C is a higher magnification of the embryo shown in figure A. Image annotations: N - neural tube; A - common atrium; V - common ventricle; 1-6 - numbered develoing branchial arches; black arrow and white arrowheads - a stream of cells emerging from the occipital neural tube, transversing the developing branchial arches 3,4 and 6, and entering the aortic sac and aorto-pulmonary outflow tract; black arrowhead - forelimb bud; open arrows - truncal ridges of the outflow tract.
Expression Pattern Description
Spatial Annotation:
EMAGE:1020Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
1020_wholemount_strong_3D_1.wlz
1020_wholemount_moderate_3D_1.wlz
1020_wholemount_possible_3D_1.wlz
1020_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:1020_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
neural tube
detected detected
outflow tract
detected detected
regionalStreams of cells were detected passing though the developing third, fourth, and sixth branchial arches and entering the aorto-pulmonary outflow tract.
embryo
detected detected
regionalStreams of cells were detected passing though the developing third, fourth, and sixth branchial arches and entering the aorto-pulmonary outflow tract.
branchial arch
detected detected
regionalStreams of cells were detected passing though the developing third, fourth, and sixth branchial arches and entering the aorto-pulmonary outflow tract.
3rd branchial arch
detected detected
regionalStreams of cells were detected passing though the developing third, fourth, and sixth branchial arches and entering the aorto-pulmonary outflow tract.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1101193
Entity Detected:Pax3, paired box gene 3 ( MGI:97487)
Sequence:sense strand is shown

>MGI:1101193
AAGCTTACCGAGGCCCGAGTGCAGGTCTGGTTTAGCAACCGCCGTGCAAGATGGAGGAAACAAGCTGGAG
CCAATCAACTGATGGCTTTCAACCATCTCATTCCGGGGGGATTCCCTCCCACCGCCATGCCGACCCTGCC
AACATACCAGCTGTCGGAGACCTCTTACCAGCCCACGTCTATTCCACAAGCCGTGTCAGATCCCAGTAGC
ACCGTCCACAGACCTCAGCCGCTTCCTCCGAGCACTGTACACCAAAGCACTATTCCTTCGAACGCAGACA
GCAGCTCTGCCTACTGCCTCCCCAGCACCAGGCATGGATTTTCAAGCTATACAGACAGCTTTGTGCCTCC
ATCGGGGCCCTCCAACCCCATGAACCCCACCATCGGCAATGGCCTTTCACCTCAGGTAATGGGACTTCTG
ACCAACCACGGTGGGGTACCGCACCAGCCTCAGACCGACTATGCTCTCTCCCCTCTCACTGGGGGCCTGG
AACCCACGACCACGGTGTCAGCCAGCTGCA
nt 1157 - nt 1676 of NM_008781.2
Notes:The Pax3 probe used in this study by Conway et al., 1997 [PMID:9053326] is described as "a 516 base pair HindIII-PstI fragment cloned from the 3' end (base pairs 1071 to 1590) of the Pax3 gene (Goulding et al., 1991 [PMID:2022185] )." Restriction analysis of GenBank seq NM_008781.2 with HindIII and PstI reveals a fragment of suitable size (ie. nt 1157-1676 as noted above).
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:C3H/101 x CBA/Ca
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Conway et al., 1997 [PMID:9053326] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9053326] Conway SJ, Henderson DJ, Copp AJ 1997 Pax3 is required for cardiac neural crest migration in the mouse: evidence from the splotch (Sp2H) mutant. Development (124):505-14
 [ PMID:2022185] Goulding MD, Chalepakis G, Deutsch U, Erselius JR, Gruss P 1991 Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J (10):1135-47
Links:MGI:1334345 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI