Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10200

Nutf2 nuclear transport factor 2 ( MGI:1915301)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200
"Pseudo-wholemount" of euxassay_000009. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000009_01 euxassay_000009_02 euxassay_000009_03 euxassay_000009_04
EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200
euxassay_000009_05 euxassay_000009_06 euxassay_000009_07 euxassay_000009_08 euxassay_000009_09
EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200
euxassay_000009_10 euxassay_000009_11 euxassay_000009_12 euxassay_000009_13 euxassay_000009_14
EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200
euxassay_000009_15 euxassay_000009_16 euxassay_000009_17 euxassay_000009_18 euxassay_000009_19
EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200 EMAGE:10200
euxassay_000009_20 euxassay_000009_21 euxassay_000009_22 euxassay_000009_23 euxassay_000009_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10200Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10200_wholemount_strong.wlz
10200_wholemount_moderate.wlz
10200_wholemount_weak.wlz
10200_wholemount_possible.wlz
10200_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10200_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 15
sublingual gland primordium
strong strong
regionalstrong expression: see section 14
submandibular gland primordium
strong strong
regionalstrong expression: see section 09 10 11 12 20 21 22 23 24
submandibular gland primordium epithelium
strong strong
regionalstrong expression: see section 10 11
submandibular gland primordium mesenchyme
strong strong
regionalstrong expression: see section 10
nervous system
strong strong
regionalstrong expression: see section 04 08
central nervous system
strong strong
regionalstrong expression: see section 08 21
brain
strong strong
regionalstrong expression: see section 06 08 21
forebrain
strong strong
regionalstrong expression: see section 06 08 20
physiological umbilical hernia
strong strong
regionalstrong expression: see section 18 19 20
physiological umbilical hernia dermis
moderate moderate
spottedmoderate expression: see section 15 16
vibrissa
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 22 23 24
vibrissa dermal component
strong strong
regionalstrong expression: see section 06 07 08 09 10
vibrissa epidermal component
strong strong
regionalstrong expression: see section 10 11
telencephalon
strong strong
regionalstrong expression: see section 03 04 06 07 08 11 19 20 21
cerebral cortex
strong strong
regionalstrong expression: see section 04 06 07 08 10 11 19 20 21 22 23 24
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 18 19 21 22
cerebral cortex ventricular layer
strong strong
regionalstrong expression: see section 03 04 06 07 08 10 11 18 19 20 21 22 23 24
cerebellum
moderate moderate
regionalmoderate expression: see section 19
rest of cerebellum
moderate moderate
regionalmoderate expression: see section 18 21
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 18 19 21
midbrain lateral wall
strong strong
regionalstrong expression: see section 15
midbrain mantle layer
strong strong
spottedstrong expression: see section 16 18
midbrain ventricular layer
strong strong
regionalstrong expression: see section 15 16 18
facial vii ganglion
strong strong
homogeneousstrong expression: see section 10 11 19 20
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 10 11 20 22
vagus x ganglion
strong strong
regionalstrong expression: see section 21
trigeminal v nerve
strong strong
homogeneousstrong expression: see section 10
spinal cord floor plate
moderate moderate
regionalmoderate expression: see section 19
basal columns
moderate moderate
regionalmoderate expression: see section 19
dorsal root ganglion
strong strong
regionalstrong expression: see section 14 21 moderate expression: see section 18 19 20
ear
strong strong
regionalstrong expression: see section 04
inner ear
strong strong
regionalstrong expression: see section 04 06 moderate expression: see section 03
otic capsule
strong strong
spottedstrong expression: see section 04 moderate expression: see section 03
nasal cavity
moderate moderate
regionalmoderate expression: see section 15
nasal cavity epithelium
moderate moderate
regionalmoderate expression: see section 15
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
lower jaw
strong strong
regionalstrong expression: see section 09 14 moderate expression: see section 08 11
mandible
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 11 12
lower jaw mesenchyme
strong strong
regionalstrong expression: see section 09 10 moderate expression: see section 08
lower jaw tooth
strong strong
regionalstrong expression: see section 10 14 moderate expression: see section 11 12 18
lower jaw incisor
strong strong
regionalstrong expression: see section 14 15 20 moderate expression: see section 12 18
lower jaw molar
strong strong
regionalstrong expression: see section 04
upper jaw
strong strong
homogeneousstrong expression: see section 10 14
upper jaw tooth
strong strong
regionalstrong expression: see section 10 15 20 moderate expression: see section 18
upper jaw incisor
strong strong
regionalstrong expression: see section 14 20 moderate expression: see section 18
liver and biliary system
strong strong
regionalstrong expression: see section 09
liver
strong strong
regionalstrong expression: see section 03 06 07 08 09 10 11 14 22 moderate expression: see section 18 23 weak expression: see section 12 24
liver lobe
moderate moderate
spottedmoderate expression: see section 16
urinary system
strong strong
regionalstrong expression: see section 12
metanephros
strong strong
regionalstrong expression: see section 11 12 22 moderate expression: see section 20
metanephros
strong strong
regionalstrong expression: see section 11 12
renal cortex
strong strong
regionalstrong expression: see section 22 moderate expression: see section 20 23
male reproductive system
strong strong
spottedstrong expression: see section 08 moderate expression: see section 06
testis
strong strong
regionalstrong expression: see section 07 08 moderate expression: see section 06
testis
moderate moderate
spottedmoderate expression: see section 06
lung
strong strong
spottedstrong expression: see section 07 08 10 11 12 14 19 20 21 22 23 24 moderate expression: see section 16 18
left lung
strong strong
regionalstrong expression: see section 12
right lung
strong strong
regionalstrong expression: see section 07 08 weak expression: see section 06
nucleus pulposus
strong strong
regionalstrong expression: see section 16
temporal bone
strong strong
regionalstrong expression: see section 04
temporal bone petrous part
strong strong
regionalstrong expression: see section 03 04
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1463
Entity Detected:Nutf2, nuclear transport factor 2 ( MGI:1915301)
Sequence:sense strand is shown

>T1463
TCGAGNCTGGTTGGCCTACTGGATCGTGCCAGCCCCACGGGTCTCAGAGGTGGGTGACCCTCCAGGATGG
GAGACAAGCCAATTTGGGAGCAGATTGGATCCAGCTTTATTCAACATTACTACCAGTTATTTGATAACGA
CAGAACCCAACTAGGCGCAATTTATATTGATGCATCATGCCTTACATGGGAAGGACAGCAGTTCCAGGGG
AAAGCTGCCATTGTGGAGAAGCTATCTAGCCTTCCGTTCCAGAAAATTCAGCATAGCATCACGGCGCAGG
ACCACCAGCCTACACCAGATAGCTGCATCATCAGCATGGTTGTGGGCCAGCTCAAGGCTGATGAAGATCC
CATCATGGGTTTCCACCAGATGTTTCTATTAAAGAACATCAACGATGCTTGGGTTTGCACCAATGACATG
TTCAGGCTTGCCCTGCACAACTTCGGCTGACCTCCTCCTGGCCACAGTCACGCTGTTTCCTCCTCCCTCT
TCCCAATCCTAGCTCACTCCTCCAGATGCTCCAAATATCATACACAAACGAGCAGGGCCGAGGCGGGAGC
GGGTGCAGG
Notes:The probe template was PCR amplified from IMAGE:2536710 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2536710 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10196 same embryo
 EMAGE:10202 same embryo
 EMAGE:10198 same embryo
 EMAGE:10199 same embryo
 EMAGE:10201 same embryo
 EMAGE:10197 same embryo
 EurExpress:euxassay_000009 same experiment
 MGI:4826837 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS