Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10202

Eif2b1 eukaryotic translation initiation factor 2B, subunit 1 (alpha) ( MGI:2384802)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202
"Pseudo-wholemount" of euxassay_000005. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000005_01 euxassay_000005_02 euxassay_000005_03 euxassay_000005_04
EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202
euxassay_000005_05 euxassay_000005_06 euxassay_000005_07 euxassay_000005_08 euxassay_000005_09
EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202
euxassay_000005_10 euxassay_000005_11 euxassay_000005_12 euxassay_000005_13 euxassay_000005_14
EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202
euxassay_000005_15 euxassay_000005_16 euxassay_000005_17 euxassay_000005_18 euxassay_000005_19
EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202 EMAGE:10202
euxassay_000005_20 euxassay_000005_21 euxassay_000005_22 euxassay_000005_23 euxassay_000005_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10202Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10202_wholemount_strong.wlz
10202_wholemount_moderate.wlz
10202_wholemount_weak.wlz
10202_wholemount_possible.wlz
10202_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10202_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
l1 nucleus pulposus
strong strong
homogeneousstrong expression: see section 16 17
t1 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t2 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t3 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t4 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t5 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t6 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t7 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t8 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t9 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t10 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t11 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
t12 nucleus pulposus
strong strong
homogeneousstrong expression: see section 17
submandibular gland primordium
strong strong
homogeneousstrong expression: see section 21 23
submandibular gland primordium epithelium
strong strong
spottedstrong expression: see section 09 10 11 12 21 23
physiological umbilical hernia
strong strong
regionalstrong expression: see section 15 16 17 20 21 22
physiological umbilical hernia dermis
strong strong
homogeneousstrong expression: see section 15
vibrissa
strong strong
homogeneousstrong expression: see section 08 11 moderate expression: see section 09 10
epithalamus ventricular layer
weak weak
homogeneousweak expression: see section 15
pineal primordium
strong strong
homogeneousstrong expression: see section 15 16
telencephalon
weak weak
regionalweak expression: see section 12
cerebral cortex
weak weak
homogeneousweak expression: see section 05
cerebral cortex mantle layer
moderate moderate
homogeneousmoderate expression: see section 06 13 18 weak expression: see section 05 07 08 14
cerebral cortex marginal layer
strong strong
regionalstrong expression: see section 03 weak expression: see section 05
cerebral cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 06 13 18 19 20 23 weak expression: see section 05 07 08 09 10 12 14 21
olfactory lobe
moderate moderate
spottedmoderate expression: see section 14
medulla oblongata
strong strong
regionalstrong expression: see section 09
medulla oblongata alar plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 10
medulla oblongata basal plate mantle layer
moderate moderate
homogeneousmoderate expression: see section 11 12 19 20
pons mantle layer
strong strong
spottedstrong expression: see section 09 moderate expression: see section 20
midbrain
strong strong
regionalstrong expression: see section 09
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 20
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 11 20
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 05 08 moderate expression: see section 09 11 20 21 23
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 11 12 20
vestibulocochlear viii ganglion
moderate moderate
homogeneousmoderate expression: see section 11 12 20
sympathetic ganglion
moderate moderate
homogeneousmoderate expression: see section 12
cervico-thoracic ganglion
moderate moderate
homogeneousmoderate expression: see section 12 13 14 20
inferior cervical ganglion
moderate moderate
homogeneousmoderate expression: see section 20
middle cervical ganglion
moderate moderate
homogeneousmoderate expression: see section 20
thoracic ganglion
moderate moderate
homogeneousmoderate expression: see section 14 15
dorsal root ganglion
moderate moderate
homogeneousmoderate expression: see section 13 14 19 20 21
lens anterior epithelium
strong strong
homogeneousstrong expression: see section 02
upper jaw tooth
moderate moderate
regionalmoderate expression: see section 08
liver
strong strong
single cellstrong expression: see section 03 04 05 06 07 08 10 11 12 13 16 17 18 19 21 22
liver lobe
strong strong
single cellstrong expression: see section 04 09
male reproductive system
strong strong
spottedstrong expression: see section 10
testis
strong strong
spottedstrong expression: see section 07 08 09 10
lung
strong strong
spottedstrong expression: see section 10 11 12
left lung
strong strong
spottedstrong expression: see section 22 23
chondrocranium
moderate moderate
regionalmoderate expression: see section 03
temporal bone petrous part
strong strong
homogeneousstrong expression: see section 03 moderate expression: see section 06
frontal bone primordium
strong strong
homogeneousstrong expression: see section 02 03
inter-parietal bone primordium
strong strong
homogeneousstrong expression: see section 02 03
parietal bone
strong strong
homogeneousstrong expression: see section 02 03
temporal bone
strong strong
homogeneousstrong expression: see section 02 03
temporal bone squamous part
strong strong
homogeneousstrong expression: see section 02 03
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1461
Entity Detected:Eif2b1, eukaryotic translation initiation factor 2B, subunit 1 (alpha) ( MGI:2384802)
Sequence:sense strand is shown

>T1461
TCCTCGAGCCTGTTGGCCTACTGGAAGTCGCTCGAGGAAGCCATGGAGGACGGTGAGTTAATTGAATACT
TTAAGTCTCAGATGAAAGGAGATCCTAAAATGGCCTCAGCTGTGGCTGCCATCCAGACTTTGTTGGAATT
CTTGAAGAGAGATAAAGGAGAAACACTCCAGGGCCTGAGAGCAAATCTCACCTATGCCATAAAAACCCTC
TGTGGTGTGGACTCCTCAGTGGCCGTGTCATCTGGCGGGGAGCTCTTCCTTCGCTTCATCAGCCTCACCT
CCCTGGAATACTCTGACTACTCCAAATGTAAGAAGATCATGATTGAGAGAGGAGAGCTGTTCCTGAGAAG
AATATCCCTGTCGAGAAATAAGATTGCCAATCTGTGTCATACATTCATCAAAGACGGGGCGAGAATTTTG
ACTCACGCCTACTCCAGAGTTGTCTTAAGAGTCCTGGAAGAAGCCGTGGCAGCCAAGAAACGGTTCAGTG
TGTATATCACGGAGTCGCAGCCTGATTTATCTGGTAAGAAAATGGCCAAAGCCCTCTCCCACCTCAACGT
CCCTGTCACTGTGGTGCTGGATGCTG
Notes:The probe template was PCR amplified from IMAGE:2536691 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2536691 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10196 same embryo
 EMAGE:10200 same embryo
 EMAGE:10198 same embryo
 EMAGE:10199 same embryo
 EMAGE:10201 same embryo
 EMAGE:10197 same embryo
 EurExpress:euxassay_000005 same experiment
 MGI:4824502 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS