Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10203

Arf4 ADP-ribosylation factor 4 ( MGI:99433)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203
"Pseudo-wholemount" of euxassay_000003. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000003_01 euxassay_000003_02 euxassay_000003_03 euxassay_000003_04
EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203
euxassay_000003_05 euxassay_000003_06 euxassay_000003_07 euxassay_000003_08 euxassay_000003_09
EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203
euxassay_000003_10 euxassay_000003_11 euxassay_000003_12 euxassay_000003_13 euxassay_000003_14
EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203
euxassay_000003_15 euxassay_000003_16 euxassay_000003_17 euxassay_000003_18 euxassay_000003_19
EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203 EMAGE:10203
euxassay_000003_20 euxassay_000003_21 euxassay_000003_22 euxassay_000003_23 euxassay_000003_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10203Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10203_wholemount_strong.wlz
10203_wholemount_moderate.wlz
10203_wholemount_weak.wlz
10203_wholemount_possible.wlz
10203_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10203_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
cervical intervertebral disc
strong strong
homogeneousstrong expression: see section 17 moderate expression: see section 18
lumbar intervertebral disc
strong strong
homogeneousstrong expression: see section 17
lumbar vertebral cartilage condensation
moderate moderate
homogeneousmoderate expression: see section 02
thoracic intervertebral disc
strong strong
homogeneousstrong expression: see section 15 16 17 moderate expression: see section 14 18
diaphragm
strong strong
regionalstrong expression: see section 19 20 21 22 23 24
limb
strong strong
regionalstrong expression: see section 01 02 03 04 05
forelimb
strong strong
regionalstrong expression: see section 01 03
arm
strong strong
regionalstrong expression: see section 01
hand mesenchyme
strong strong
regionalstrong expression: see section 03
hindlimb
strong strong
regionalstrong expression: see section 01 03 05
foot mesenchyme
strong strong
regionalstrong expression: see section 03
leg
strong strong
regionalstrong expression: see section 01
tibia
moderate moderate
regionalmoderate expression: see section 24
femur
strong strong
regionalstrong expression: see section 21 22 moderate expression: see section 23 24
oral region
moderate moderate
regionalmoderate expression: see section 05
not examined not examined
othernot examined expression: see section 13
foregut
strong strong
regionalstrong expression: see section 06
vibrissa
strong strong
regionalstrong expression: see section 05 06 07 08 20 21 22
vibrissa dermal component
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 moderate expression: see section 09
vibrissa epidermal component
strong strong
regionalstrong expression: see section 03
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 15
medullary raphe
strong strong
regionalstrong expression: see section 16 17 18
metencephalon floor plate
strong strong
regionalstrong expression: see section 15
pons
strong strong
homogeneousstrong expression: see section 12 moderate expression: see section 10 11
facial vii ganglion
strong strong
regionalstrong expression: see section 11 12 moderate expression: see section 10
trigeminal v ganglion
strong strong
regionalstrong expression: see section 08 09 moderate expression: see section 10 19
vagus x ganglion
strong strong
regionalstrong expression: see section 14
facial vii nerve
strong strong
homogeneousstrong expression: see section 18 19 moderate expression: see section 11 12
hypoglossal xii nerve
strong strong
regionalstrong expression: see section 14
oculomotor iii nerve
moderate moderate
homogeneousmoderate expression: see section 11
trigeminal v nerve
strong strong
regionalstrong expression: see section 19 moderate expression: see section 12 weak expression: see section 18
spinal cord
strong strong
regionalstrong expression: see section 14 15
spinal cord floor plate
strong strong
otherstrong expression: see section 15 not examined expression: see section 14
basal columns
strong strong
regionalstrong expression: see section 14 16 17 18 19
dorsal root ganglion
strong strong
regionalstrong expression: see section 19
cornea epithelium
moderate moderate
homogeneousmoderate expression: see section 02 03
cornea stroma
moderate moderate
homogeneousmoderate expression: see section 02 03
neural retina
moderate moderate
regionalmoderate expression: see section 24
nose
moderate moderate
regionalmoderate expression: see section 09 10 17
anterior naris epithelium
strong strong
regionalstrong expression: see section 18
external naris epithelium
moderate moderate
regionalmoderate expression: see section 17
nasal capsule
strong strong
regionalstrong expression: see section 15 16 18 moderate expression: see section 17
nasal cavity
strong strong
regionalstrong expression: see section 15 16 18 19 20 21 23 moderate expression: see section 09 13 17 weak expression: see section 14
nasal cavity epithelium
strong strong
regionalstrong expression: see section 15 16 18 moderate expression: see section 11 12 13 17 weak expression: see section 14
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 18 moderate expression: see section 11 12 17
nasal septum
strong strong
regionalstrong expression: see section 15 16 moderate expression: see section 12 13 weak expression: see section 14
nasal septum epithelium
strong strong
regionalstrong expression: see section 16 moderate expression: see section 11 12 13 weak expression: see section 14
viscerocranium
strong strong
regionalExpression in the turbinate bone.
foregut duodenum
strong strong
homogeneousstrong expression: see section 06
stomach
strong strong
homogeneousstrong expression: see section 02 03 05 06
stomach fundus
strong strong
homogeneousexpression in the associated mesenchyme.
stomach fundus epithelium
strong strong
homogeneousstrong expression: see section 03 04 05
stomach fundus mucosa
strong strong
homogeneousstrong expression: see section 04
stomach glandular region
strong strong
homogeneousstrong expression: see section 02 03 05
stomach glandular region epithelium
strong strong
homogeneousstrong expression: see section 02 03 04 05
stomach glandular region mucosa
strong strong
homogeneousstrong expression: see section 02 04
stomach proventricular region epithelium
strong strong
homogeneousstrong expression: see section 06
stomach pyloric region
strong strong
homogeneousstrong expression: see section 04 05
stomach pyloric region epithelium
strong strong
homogeneousstrong expression: see section 04 05 06
foregut-midgut junction duodenum
moderate moderate
homogeneousmoderate expression: see section 07
foregut-midgut junction epithelium
moderate moderate
homogeneousmoderate expression: see section 07
lower jaw
strong strong
regionalstrong expression: see section 07 moderate expression: see section 04 05
lower jaw skeleton
strong strong
regionalstrong expression: see section 19 20 21 22 moderate expression: see section 23 24
mandible
strong strong
regionalstrong expression: see section 09 18 moderate expression: see section 04 05 08 10
lower jaw mesenchyme
strong strong
regionalstrong expression: see section 07 moderate expression: see section 10 13 14
oral epithelium
moderate moderate
regionalmoderate expression: see section 08
skeleton
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 17
axial skeleton
strong strong
regionalstrong expression: see section 03 11 15 17 20 21 22 23 24 moderate expression: see section 18
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 18 19 20
frontal bone primordium
strong strong
regionalstrong expression: see section 24
pectoral girdle and thoracic body wall skeleton
moderate moderate
homogeneousmoderate expression: see section 12
clavicle
strong strong
regionalstrong expression: see section 18 19 20 moderate expression: see section 12
tail skeleton
strong strong
regionalstrong expression: see section 16
axial skeleton tail region
strong strong
regionalstrong expression: see section 16 17
tail vertebral cartilage condensation
strong strong
homogeneousstrong expression: see section 12 13 15 16 17 moderate expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2260
Entity Detected:Arf4, ADP-ribosylation factor 4 ( MGI:99433)
Sequence:sense strand is shown

>T2260
TTTTTTTTTTTTTTGAGAAAGGTCTAATGCTGGCCTCAAACTCAGTAAGTGGACAATGATTTCTGCCATC
TCTGTGGCACGTGATAGTGGGCTCAAACTCACTGTATACAAGGCAAGCTTCATCACCAATGAATCATCAC
TGGCTGAGCTTCATCAGCAACCCCTTCATACTCTGCTTCTGGAGTTCATATTATGATAACTTGTTCTTGT
TCTTCTTGATCTGACCTTTGAACTTCATAGCTTCAAATGGTATTCTACTAGAAAAATTAAAATTCTTCAT
AGTGCACCTTACTTTAATGCACATGATAACCCATGGCTAAGTTTACTGACAACTTAAACCATAAGTAAAT
TCACTGGGATTTGGCCATACTTTGTTATGTAAGGAAATCAGTTTCAAATATTGCAAAGTCTCAAAAGAAC
ACACAATCATGTTTTTTAAAATCATTTTATTAGGAATAATTCCAAATGGGTTATGAAGAAAACTTATTCA
TTGAATTTGATGAGTTTTCAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1066958 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1066958 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4823209 same experiment
 EurExpress:euxassay_000003 same experiment
 EMAGE:31408 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS