Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:1021

Pax3 paired box gene 3 ( MGI:97487)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:1021 EMAGE:1021 EMAGE:1021
Figure 8C of Conway et al., 1997 [PMID:9053326] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 8A of Conway et al., 1997 [PMID:9053326] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright. Figure 8B of Conway et al., 1997 [PMID:9053326] Copyright: This image is from Development and is displayed with the permission of The Company of Biologists Ltd. who owns the copyright.

Expression pattern clarity: three stars
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
Figure B is a brightfield image of the section shown in figure C. Figure A is a lower magnification image showing the area covered by figure B in the box. Image annotations: A - atrial chamber; Ao - dorsal aorta; 1-4 - numbered branchial arches; white arrowhead indicates a group of Pax3-positive neural crest cells; black arrowhead indicates same area (as white arrowhead) on the brightfield section.
Expression Pattern Description
Spatial Annotation:
EMAGE:1021EMAGE:1021Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping3D context movie

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
1021_voxel_strong_3D_1.wlz
1021_voxel_possible_3D_1.wlz
1021_voxel_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:1021_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
branchial arch
detected detected
regionalPax-3 positive cels were observed in control embryos within pharyngeal arches 4 and 6, at the junction of the aortic sac.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1101193
Entity Detected:Pax3, paired box gene 3 ( MGI:97487)
Sequence:sense strand is shown

>MGI:1101193
AAGCTTACCGAGGCCCGAGTGCAGGTCTGGTTTAGCAACCGCCGTGCAAGATGGAGGAAACAAGCTGGAG
CCAATCAACTGATGGCTTTCAACCATCTCATTCCGGGGGGATTCCCTCCCACCGCCATGCCGACCCTGCC
AACATACCAGCTGTCGGAGACCTCTTACCAGCCCACGTCTATTCCACAAGCCGTGTCAGATCCCAGTAGC
ACCGTCCACAGACCTCAGCCGCTTCCTCCGAGCACTGTACACCAAAGCACTATTCCTTCGAACGCAGACA
GCAGCTCTGCCTACTGCCTCCCCAGCACCAGGCATGGATTTTCAAGCTATACAGACAGCTTTGTGCCTCC
ATCGGGGCCCTCCAACCCCATGAACCCCACCATCGGCAATGGCCTTTCACCTCAGGTAATGGGACTTCTG
ACCAACCACGGTGGGGTACCGCACCAGCCTCAGACCGACTATGCTCTCTCCCCTCTCACTGGGGGCCTGG
AACCCACGACCACGGTGTCAGCCAGCTGCA
nt 1157 - nt 1676 of NM_008781.2
Notes:The Pax3 probe used in this study by Conway et al., 1997 [PMID:9053326] is described as "a 516 base pair HindIII-PstI fragment cloned from the 3' end (base pairs 1071 to 1590) of the Pax3 gene (Goulding et al., 1991 [PMID:2022185] )." Restriction analysis of GenBank seq NM_008781.2 with HindIII and PstI reveals a fragment of suitable size (ie. nt 1157-1676 as noted above).
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:C3H/101 x CBA/Ca
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:section
Procedures
Embedding:paraffin
General Information
Authors:Conway et al., 1997 [PMID:9053326] Indexed by GXD, Spatially Mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9053326] Conway SJ, Henderson DJ, Copp AJ 1997 Pax3 is required for cardiac neural crest migration in the mouse: evidence from the splotch (Sp2H) mutant. Development (124):505-14
 [ PMID:2022185] Goulding MD, Chalepakis G, Deutsch U, Erselius JR, Gruss P 1991 Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. EMBO J (10):1135-47
Links:MGI:1334345 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI