Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10220

Slc35f1 solute carrier family 35, member F1 ( MGI:2139810)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220
"Pseudo-wholemount" of euxassay_019705. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019705_01 euxassay_019705_02 euxassay_019705_03 euxassay_019705_04
EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220
euxassay_019705_05 euxassay_019705_06 euxassay_019705_07 euxassay_019705_08 euxassay_019705_09
EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220
euxassay_019705_10 euxassay_019705_11 euxassay_019705_12 euxassay_019705_13 euxassay_019705_14
EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220
euxassay_019705_15 euxassay_019705_16 euxassay_019705_17 euxassay_019705_18 euxassay_019705_19
EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220 EMAGE:10220
euxassay_019705_20 euxassay_019705_21 euxassay_019705_22 euxassay_019705_23 euxassay_019705_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10220Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10220_wholemount_strong.wlz
10220_wholemount_moderate.wlz
10220_wholemount_weak.wlz
10220_wholemount_possible.wlz
10220_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10220_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 15 16
hypothalamus ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 15 16 17 18
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 22 23 24 weak expression: see section 21
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 17 18
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 10 15 16
rest of cerebellum
moderate moderate
regionalmoderate expression: see section 05
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 04 06 07 08 09 10 13 14 15 16
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 20 weak expression: see section 18 19
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 10 14 15 weak expression: see section 17
pons ventricular layer
weak weak
regionalweak expression: see section 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 weak expression: see section 17
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 18 19 20 21 22
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 14 15
intermediate grey horn
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
dorsal root ganglion
weak weak
regionalweak expression: see section 06 07 08 09 10 11 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T56026
Entity Detected:Slc35f1, solute carrier family 35, member F1 ( MGI:2139810)
Sequence:sense strand is shown

>T56026
AGGGGCAAGAAAGGTTTGTGCTAAAGCTACATCACATAATAACCTTGCAAATATCTGCTCTGTGCTACCT
TTTAAGCCAATTAAATATCTTTCTCTGAATATTTTGTCCATTCAGATCTGAAGACCCTTAATGACTGTGG
TTTTACTTTTATGTTTACATTCCTTCAGTTTGCATAATTTACTTGATTTATTGCATTTTTAGTATTTATT
TTAAGCCAAATGTCTTTGTCTTTTATTCATTTTTATGACACTAATTTGTAGACACTCTGTAAACTCTAAT
GAGAAACAAATGGCTGAGATTATTTCCAAGTCCATTCAGTAGGCTGGGAATAATTTTAAAGTTACATTTT
GAAAAGGTTTGCAATTAATTGATGGCTAAAGATGGCTGTCTGGACCATTTCATAGGATGAAATTGACTCC
ATTGTATGGAAACCAAATGTGAATATCAGGATGAACTCATTGTATACTTTTTGTCATCCAGTGTCTTTGT
GATCAGACATTAATGCACCTGTGTTGGTTTATCTCCATTCATGAAGCTGGTAACATTGGCTCATCCAAGA
CTAGGAGTTTAGGATTGACCCTTAAGGGAAAAAGACAAAAAGTTGCAAAGAAAAATGTTTTTAATCTGAA
AGCATTGGTGGTTTGACAGCGGGGCGGGAAGTGGGAATAGGGTAATAGTAACTGTAGCAGTTTTAGTTTC
TGAGATTCCGTAACCTCAGTAGACACCAGCAAGAATTCCGGCATTTTAATCTACCACTCTTCTCACCTCA
AGCAAGAACAGTCCTCTGTATGAAGTTGATAAGAAGCAAACCACAGCTCTCTTAAACCCTACCAGAGATG
AGTGGTGGTTTTCACTTTCTCGGTGGAGACTTTCACTGAGGACAGAGCTTGCCTTGGTCAGACCTACTCA
CAGCTTCGAACACATATACAGGTAGACCAAGAAATGGACAAGTTCGCACCACTGTGTCCCATGAAG
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGGGGCAAGAAAGGTTTGTG; Reverse Primer - name:unspecified, sequence:CTTCATGGGACACAGTGGTG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10221 same embryo
 EMAGE:10219 same embryo
 EurExpress:euxassay_019705 same experiment
 MGI:4828205 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS