Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10221

Slc38a1 solute carrier family 38, member 1 ( MGI:2145895)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221
"Pseudo-wholemount" of euxassay_019706. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019706_01 euxassay_019706_02 euxassay_019706_03 euxassay_019706_04
EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221
euxassay_019706_05 euxassay_019706_06 euxassay_019706_07 euxassay_019706_08 euxassay_019706_09
EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221
euxassay_019706_10 euxassay_019706_11 euxassay_019706_12 euxassay_019706_13 euxassay_019706_14
EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221
euxassay_019706_15 euxassay_019706_16 euxassay_019706_17 euxassay_019706_18 euxassay_019706_19
EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221 EMAGE:10221
euxassay_019706_20 euxassay_019706_21 euxassay_019706_22 euxassay_019706_23 euxassay_019706_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10221Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10221_wholemount_strong.wlz
10221_wholemount_moderate.wlz
10221_wholemount_weak.wlz
10221_wholemount_possible.wlz
10221_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10221_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 10 11 12 13 14 15
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 17 18 moderate expression: see section 08 09
thyroid gland
weak weak
regionalweak expression: see section 10 14 15
vibrissa
moderate moderate
regionalmoderate expression: see section 06 07 23 weak expression: see section 08 22
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 07 08 09 10 13 14 15
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 weak expression: see section 06 07 08 09 10 13 14 15 16 17 18
cerebral cortex mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 13 14 19 20 21 22 23
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 11 12 13 16 17 18 19
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17
rest of cerebellum mantle layer
weak weak
regionalweak expression: see section 05 06 07 10 16 17
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 02 03 04 18 19 20 weak expression: see section 05 07 15 16 17
pons mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 15 16 17
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 weak expression: see section 14 15 16 17 18
facial vii ganglion
strong strong
regionalstrong expression: see section 02 03 04 19 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 05 06 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 17 18 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 07 17
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 05 06 18
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 17
ventral grey horn
moderate moderate
regionalmoderate expression: see section 07 09 10 11 12 13 14 15 16 17 18 weak expression: see section 08
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 09 15
cervical ganglion
strong strong
regionalstrong expression: see section 08 16
thoracic ganglion
strong strong
regionalstrong expression: see section 12 13 14 15
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
neural retina
strong strong
regionalstrong expression: see section 01 02 03 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 11 12 13 15 16 17 weak expression: see section 08 09 10 18 19 20
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 12 13 16
stomach
weak weak
regionalweak expression: see section 02 03 04 05 06 07
midgut
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 17 moderate expression: see section 16 18
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 16 17
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 17 weak expression: see section 16
metanephros
moderate moderate
regionalmoderate expression: see section 07 08 09 10 18 19 20 weak expression: see section 21
testis
weak weak
regionalweak expression: see section 05 06 07 21 22
lung
strong strong
regionalstrong expression: see section 13 moderate expression: see section 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23 weak expression: see section 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T56027
Entity Detected:Slc38a1, solute carrier family 38, member 1 ( MGI:2145895)
Sequence:sense strand is shown

>T56027
ACCGCTGAAGTCACTGTGTGTCCCCTCTTGCCTCAGCTGGGGACGGCAGGAGGACCCTTCCTGCCTGTGA
TTGTTTTTTCCCTTTTGTCCCATTATGCCTGTCCCATGTGACCCAGGCAAGAGGGCAGAGTTGCCCATCC
TCTCGCCAGTCCCTCCTAAGGGGAGCAGAGGGGAAACTTCAAGGAGACTGAAAACTGTTTCAGAGATGGC
AGCTCAGCATGCCGTAATGATGGGGATATCTGTGGATGCCCATAGCTAAGCTACAGTAGGTGAGGCGCGC
GCGCGCACGGTGACCGCTCTCTGCAAAAGGCCTGAATTGCAGCCAGTTGTATCCTGGTTGAAAGTCTCAG
ATCCAAATACTCACTGAGCACAGATTTCTCATCTGGGGGTGAGTAGAAGCTAACAGAGGAGGCCCAGACA
CTTAGCTATAGACGCTATACCTCCCGTCTGACACCCCCCAGAGGTTTTTCAGGAATCTCACGAGAGTCAC
GCAGAGATGTCCCTTACCACACTGAAGTCCCCGCAGACAGGGTTAGGCATCAAAGTACCTGCCACCATGC
TCCTGGGGAAGAAAGAAAATCTGTTTTCTGCATTGCTTCGCTTGTTCTCATACTGCTCCAGAGTTCTGTC
CTCCTCGTTCAGGCAGCTGACCACAGGTCCTAGACAGGAAAAAGGGTAAAAACCCACAGCCGCCTCTACC
CTTTGCCCTAACGCCTCCCATGTCACAAGAAATGACCACCTTTGTAGCTCTGTTTGTACTGTTTAAAAAA
TACATCAGTTTAGTTTGCAAGCTGCACCCCCCCCCTTGCTGGTGTCCCCCTTATCCTGTAACAGTTCAGT
TTTACATTTGCAAAGTGAATCCAAAAACGCACC
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ACCGCTGAAGTCACTGTGTG; Reverse Primer - name:unspecified, sequence:GGTGCGTTTTTGGATTCACT. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10220 same embryo
 EMAGE:10219 same embryo
 EurExpress:euxassay_019706 same experiment
 MGI:4828211 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS