Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10232

Acsl4 acyl-CoA synthetase long-chain family member 4 ( MGI:1354713)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10232 EMAGE:10232 EMAGE:10232 EMAGE:10232 EMAGE:10232
"Pseudo-wholemount" of euxassay_018901. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018901_01 euxassay_018901_02 euxassay_018901_03 euxassay_018901_04
EMAGE:10232 EMAGE:10232 EMAGE:10232 EMAGE:10232 EMAGE:10232
euxassay_018901_05 euxassay_018901_06 euxassay_018901_07 euxassay_018901_08 euxassay_018901_09
EMAGE:10232 EMAGE:10232 EMAGE:10232 EMAGE:10232 EMAGE:10232
euxassay_018901_10 euxassay_018901_11 euxassay_018901_12 euxassay_018901_13 euxassay_018901_14
EMAGE:10232 EMAGE:10232 EMAGE:10232 EMAGE:10232 EMAGE:10232
euxassay_018901_15 euxassay_018901_16 euxassay_018901_17 euxassay_018901_18 euxassay_018901_19
EMAGE:10232 EMAGE:10232 EMAGE:10232
euxassay_018901_20 euxassay_018901_21 euxassay_018901_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10232Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10232_wholemount_strong.wlz
10232_wholemount_moderate.wlz
10232_wholemount_weak.wlz
10232_wholemount_possible.wlz
10232_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10232_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot mesenchyme
weak weak
regionalweak expression: see section 01 02 03 19 21
vertebral axis musculature
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 17 18 19 20 21 22
adrenal gland
strong strong
regionalstrong expression: see section 09 10 11 17 18 19
thymus primordium
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17
pancreas
weak weak
regionalweak expression: see section 09 10 11 12 16
vibrissa
weak weak
regionalweak expression: see section 06 07 08 19 20 21 22
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 20 21 22
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 10 12 13 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 17 18 weak expression: see section 13 14 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 18 weak expression: see section 09
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 05 06 20 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 09 19
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 10 11
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 11 17
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 15 17 weak expression: see section 14
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 12 13 18
cervical ganglion
weak weak
regionalweak expression: see section 18
thoracic ganglion
weak weak
regionalweak expression: see section 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 11 12 18 19 weak expression: see section 09 10 13 16 17
neural retina
weak weak
regionalweak expression: see section 01 02 03 22
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 08 09 10 11 12 13 16 17 18
vomeronasal organ
weak weak
regionalweak expression: see section 13
tongue muscle
weak weak
regionalweak expression: see section 13 14 15 16
stomach
weak weak
regionalweak expression: see section 08 09 10
midgut
weak weak
regionalweak expression: see section 09 10
mandible
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 18 19 20 21 22
maxilla
weak weak
regionalweak expression: see section 05 06 07 08 09 10 18 19 20 21
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
metanephros
weak weak
regionalweak expression: see section 07 08 09 10 11 12
male reproductive system
weak weak
regionalweak expression: see section 12
lung
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 18 19 20 21 22 weak expression: see section 06 07 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50062
Entity Detected:Acsl4, acyl-CoA synthetase long-chain family member 4 ( MGI:1354713)
Sequence:sense strand is shown

>T50062
ATCCTGATGGATGCTTACAGATTATAGATCGTAAGAAAGATCTGGTAAAGTTACAAGCAGGAGAATATGT
ATCTCTTGGGAAAGTAGAAGCTGCACTGAAGAATTGTCCACTGATCGACAACATCTGTGCTTTTGCCAAA
AGTGACCAGTCCTATGTGATCAGTTTTGTGGTTCCTAACCAGAAAAAGTTGACTCTTTTGGCACAACAGA
AGGGGGTAGAAGGATCTTGGGTTGATATTTGCAATAATCCCGCCATGGAAGCTGAAATACTGAAAGAAAT
TCGAGAAGCTGCAAATGCCATGAAATTGGAGCGATTTGAAATTCCGATCAAGGTTCGGTTAAGCCCAGAG
CCATGGACCCCCGAGACTGGTTTGGTAACAGATGCCTTCAAGCTGAAAAGGAAGGAGTTGAAGAACCATT
ATCTCAAAGACATTGAGCGAATGTATGGGGGCAAATAAAATGCGGCTCTCTGATTTCCATTTGCACAGGA
GGTGGCCTGATGGTTTTTAGTTCTAGAGTTTAAGCCTTTGTTGATCTCCTTGTTAGAATATAAGGTGTAT
CTTCTAAAGACATGAAATAAAAACAACCAAAAGTCGTTAAAATAGTTGAGTCTACTTTAACTTGCATAGT
CCTAGTGAAGCTGAGATTGCAAAGACATTTCCCTTTAGCTGTGTTAAGTTTAGAGCAGAAATTCTGTTTT
TTAAAAGTAGCCTTATATACCCTTGTTTTTATGAAGAGAAGATACTCCATGCTAAAGTAAAGAAATTGGA
CTTGGAATAGATAGAATTGAAGAAATTTACAGCTTCCAGCGTCTATGTCTTCCTAGTTCAGAAGTTTCTA
TAATAATGATGACAAAATTATGTATTAACACTACTCAAAGCAGAAGCGCCACCAGGCTT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ATCCTGATGGATGCTTACAG; Reverse Primer - name:unspecified, sequence:AAGCCTGGTGGCGCTTCTGC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10231 same embryo
 EMAGE:10233 same embryo
 EurExpress:euxassay_018901 same experiment
 MGI:4822942 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS