Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10255

Ndufa9 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 ( MGI:1913358)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10255 EMAGE:10255 EMAGE:10255 EMAGE:10255 EMAGE:10255
"Pseudo-wholemount" of euxassay_018912. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018912_01 euxassay_018912_02 euxassay_018912_03 euxassay_018912_04
EMAGE:10255 EMAGE:10255 EMAGE:10255 EMAGE:10255 EMAGE:10255
euxassay_018912_05 euxassay_018912_06 euxassay_018912_07 euxassay_018912_08 euxassay_018912_09
EMAGE:10255 EMAGE:10255 EMAGE:10255 EMAGE:10255 EMAGE:10255
euxassay_018912_10 euxassay_018912_11 euxassay_018912_12 euxassay_018912_13 euxassay_018912_14
EMAGE:10255 EMAGE:10255 EMAGE:10255 EMAGE:10255 EMAGE:10255
euxassay_018912_15 euxassay_018912_16 euxassay_018912_17 euxassay_018912_18 euxassay_018912_19
EMAGE:10255 EMAGE:10255 EMAGE:10255
euxassay_018912_20 euxassay_018912_21 euxassay_018912_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10255Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10255_wholemount_strong.wlz
10255_wholemount_moderate.wlz
10255_wholemount_weak.wlz
10255_wholemount_possible.wlz
10255_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10255_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
weak weak
regionalweak expression: see section 04 05 06 07 18 19 20 21
thymus primordium
weak weak
regionalweak expression: see section 10 11 12 13 14
submandibular gland primordium
weak weak
regionalweak expression: see section 06 07 08 09 15 16 17 18
pancreas
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15
thyroid gland
weak weak
regionalweak expression: see section 10 11 14
vibrissa
weak weak
regionalweak expression: see section 05 06 07 08 19 20 21
olfactory cortex mantle layer
weak weak
regionalweak expression: see section 09 10 11 12 14 15 16
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 14 15
pons mantle layer
weak weak
regionalweak expression: see section 06 16
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21
vagus x ganglion
weak weak
regionalweak expression: see section 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 10 11 13 14
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 14 15 16 17
neural retina
weak weak
regionalweak expression: see section 01 02 22
stomach
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 13
hindgut
weak weak
regionalweak expression: see section 12
midgut
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
mandible
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 14
maxilla
weak weak
regionalweak expression: see section 05 06 07 08 09 15 16 17 18 19 20
upper jaw incisor
weak weak
regionalweak expression: see section 11 12 14
liver
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
testis
weak weak
regionalweak expression: see section 05 06 07 18 20
lung
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 21
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 03 04 weak expression: see section 01 02 05 20 21 22
clavicle
weak weak
regionalweak expression: see section 09 10 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50707
Entity Detected:Ndufa9, NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 ( MGI:1913358)
Sequence:sense strand is shown

>T50707
AGGATTCCTGGGTCGATACGTTGTTAACCACCTTGGACGAATGGGGTCACAAGTGATCATACCATATCGG
TGTGATGTATATGACATCATGCACCTTCGTCTGATGGGTGACCCGGGCCAGCTTACCTTTCTGGAATGGG
ATGCACGAGACAAAGATTCTATCAGGAAAGCAGTGCAGCACAGCAACGTGGTCATCAATCTTATTGGGCG
GGAGTGGGAAACCAGAAACTTTGATTTTGAGGATGTTTTTGTGAATATTCCTCGAGCAATAGCTCAGGCA
TCCAAGGAAGCTGGGGTTGAGAGATTCATTCATGTTTCACACCTGAATGCCAGTATGAAGAGTTCTTCTA
AGTCCTTGAGGAGCAAGGCAGTGGGAGAGAAGGAAGTGAGAAGTGTGTTTCCTGAAGCCATCATCATACG
GCCGTCTGACATTTTCGGAAGGGAGGACAGGTTCCTTAATCACTTTGCAAATTATCGTTGGTTTCTTGCT
GTGCCTCTTGTTTCTTTGGGCTTTAAGACAGTGAAGCAGCCGGTGTATGTTGCAGATGTTTCCAAGGGGA
TTGTTAATGCGACTAAGGATCCAGATGCCGTAGGAAAAACCTTTGCCTTCACTGGGCCAAACCGGTACCT
GCTCTTCCACTTGGTGAAGTACATCTTTGGCATGACCCATCGGACCTTCATCCCTTACCCTTTGCCACTA
TTTGTGTATAGCTGGATTGGCAAACTCTTTGGGCTGAGTCCATTTGAGCCCTGGACGACGAAGGACAAGG
TGGAGCGGATACATATCTCAGACGTGATGCCGACCGACCTGCCTGGCCTGGAAGATCTTGGTGTTCAGCC
CACACCACTGGAGCTCAAGTCCATTGAGGTGCT
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGGATTCCTGGGTCGATACG; Reverse Primer - name:unspecified, sequence:AGCACCTCAATGGACTTGAG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10253 same embryo
 EMAGE:10256 same embryo
 EMAGE:10254 same embryo
 EurExpress:euxassay_018912 same experiment
 MGI:4826639 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS