Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10266

Gstm5 glutathione S-transferase, mu 5 ( MGI:1309466)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10266 EMAGE:10266 EMAGE:10266 EMAGE:10266 EMAGE:10266
"Pseudo-wholemount" of euxassay_018935. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018935_01 euxassay_018935_02 euxassay_018935_03 euxassay_018935_04
EMAGE:10266 EMAGE:10266 EMAGE:10266 EMAGE:10266 EMAGE:10266
euxassay_018935_05 euxassay_018935_06 euxassay_018935_07 euxassay_018935_08 euxassay_018935_09
EMAGE:10266 EMAGE:10266 EMAGE:10266 EMAGE:10266 EMAGE:10266
euxassay_018935_10 euxassay_018935_11 euxassay_018935_12 euxassay_018935_13 euxassay_018935_14
EMAGE:10266 EMAGE:10266 EMAGE:10266 EMAGE:10266 EMAGE:10266
euxassay_018935_15 euxassay_018935_16 euxassay_018935_17 euxassay_018935_18 euxassay_018935_19
EMAGE:10266 EMAGE:10266 EMAGE:10266 EMAGE:10266
euxassay_018935_20 euxassay_018935_21 euxassay_018935_22 euxassay_018935_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10266Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10266_wholemount_strong.wlz
10266_wholemount_moderate.wlz
10266_wholemount_weak.wlz
10266_wholemount_possible.wlz
10266_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10266_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
weak weak
regionalweak expression: see section 02 03 04 18 19 20
olfactory cortex ventricular layer
moderate moderate
regionalmoderate expression: see section 12 16 17
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 15 16 17 18 19 20 21 weak expression: see section 13 22
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 07 08 14 15
pons mantle layer
weak weak
regionalweak expression: see section 06 07 16
pons ventricular layer
weak weak
regionalweak expression: see section 09 10 11
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 weak expression: see section 08 13 14
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 weak expression: see section 20
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 16 17 weak expression: see section 05
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 06 07 08 09 17 18 weak expression: see section 04 05 19 20 21
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07
ventral grey horn
moderate moderate
regionalmoderate expression: see section 13 weak expression: see section 08 09 11 12
dorsal root ganglion
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
lens
weak weak
regionalweak expression: see section 01 02
neural retina
weak weak
regionalweak expression: see section 01 02 03 04
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 13 16 17 18 weak expression: see section 10 11 12 14 15 19
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 23 weak expression: see section 12 13
urinary system
strong strong
regionalstrong expression: see section 05 06 21 22
testis
weak weak
regionalweak expression: see section 06 07 08 19 21 22
nucleus pulposus
weak weak
regionalweak expression: see section 11 12 13
clavicle
weak weak
regionalweak expression: see section 09 10 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50467
Entity Detected:Gstm5, glutathione S-transferase, mu 5 ( MGI:1309466)
Sequence:sense strand is shown

>T50467
ACAGTTCGGTCGCGTCAGCCGGCCCACAGCGTCCAGTATAAAGTTAGCCGCCCACAGTCCATCGCTGTAT
CCCCGAAGCCAAGATCGCCCAAAATGTCATCCAAGTCTATGGTTCTGGGTTACTGGGATATCCGCGGGCT
GGCTCATGCTATCCGCATGCTTCTGGAGTTTACTGATACCAGCTATGAGGAGAAACGGTACATCTGTGGG
GAAGCTCCTGACTATGATAGAAGCCAATGGCTGGACGTGAAATTCAAGCTAGATCTGGACTTTCCTAACC
TGCCCTACCTCATGGACGGGAAGAACAAGATCACCCAGAGTAACGCCATCCTGAGATACATCGCACGCAA
GCACAACATGTGTGGTGACACTGAAGAAGAAAAGATACGAGTAGACATCATGGAGAACCAGATCATGGAC
TTCCGCATGCAGCTGGTTCGCCTCTGCTACAATTCTAACCACGAAAACCTGAAGCCTCAGTACTTGGAAC
AGCTACCTGCACAGCTGAAACAATTCTCATTGTTCCTGGGGAAATTCACATGGTTTGCAGGAGAAAAGCT
GACCTTTGTGGATTTTCTCACCTATGATGTCTTGGATCAGAACCGTATATTTGAGCCCAAGTGTCTGGAT
GAGTTCCCAAACCTGAAGGCTTTCATGTGCCGTTTTGAGGCTTTGGAGAAGATTGCTGCATTCCTGCAGT
CTGACCGCTTCTTCAAGATGCCAATCAATAACAAGATGGCCAAGTGGGGTAACAAGTGCTTATGCTGAGC
CAGAGCTCGCTGCTGCTGAGCCATCTTGCCCTGAGGGGCCCACACTCTTAGCTCACTGTCAGTCTTGTTC
CATCCTGTCCTGA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:ACAGTTCGGTCGCGTCAGCC; Reverse Primer - name:unspecified, sequence:TCAGGACAGGATGGAACAAG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10267 same embryo
 EMAGE:10265 same embryo
 EurExpress:euxassay_018935 same experiment
 MGI:4825263 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS