Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10270

Slc27a1 solute carrier family 27 (fatty acid transporter), member 1 ( MGI:1347098)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10270 EMAGE:10270 EMAGE:10270 EMAGE:10270 EMAGE:10270
"Pseudo-wholemount" of euxassay_018940. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018940_01 euxassay_018940_02 euxassay_018940_03 euxassay_018940_04
EMAGE:10270 EMAGE:10270 EMAGE:10270 EMAGE:10270 EMAGE:10270
euxassay_018940_05 euxassay_018940_06 euxassay_018940_07 euxassay_018940_08 euxassay_018940_09
EMAGE:10270 EMAGE:10270 EMAGE:10270 EMAGE:10270 EMAGE:10270
euxassay_018940_10 euxassay_018940_11 euxassay_018940_12 euxassay_018940_13 euxassay_018940_14
EMAGE:10270 EMAGE:10270 EMAGE:10270 EMAGE:10270 EMAGE:10270
euxassay_018940_15 euxassay_018940_16 euxassay_018940_17 euxassay_018940_18 euxassay_018940_19
EMAGE:10270 EMAGE:10270 EMAGE:10270 EMAGE:10270
euxassay_018940_20 euxassay_018940_21 euxassay_018940_22 euxassay_018940_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10270Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10270_wholemount_strong.wlz
10270_wholemount_moderate.wlz
10270_wholemount_weak.wlz
10270_wholemount_possible.wlz
10270_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10270_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 04 21
hindlimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 04 05 20 21
hindlimb digit 3 phalanx
moderate moderate
regionalmoderate expression: see section 04 05 20 21
hindlimb digit 4 phalanx
moderate moderate
regionalmoderate expression: see section 05 06 20 21
hindlimb digit 5 phalanx
moderate moderate
regionalmoderate expression: see section 05 06 20 21
trunk mesenchyme
moderate moderate
regionalmoderate expression: see section 04 19 weak expression: see section 03 07 15 20
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 17 18 19 moderate expression: see section 07 08 09 15 16
thyroid gland
weak weak
regionalweak expression: see section 09 10 14
vibrissa
strong strong
regionalstrong expression: see section 03 04 05 06 07 19 20 21 22
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 moderate expression: see section 12
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 08 13 14 15 weak expression: see section 09
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 17 18 19 20 21 moderate expression: see section 07 08 11 12 13 14 15 16 weak expression: see section 09
medulla oblongata alar plate ventricular layer
strong strong
regionalstrong expression: see section 08 09 13
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 11 12 13
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 17 18 moderate expression: see section 03 04 19
pons ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 13 14 15 16 17
midbrain ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 17 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
ventral grey horn
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
spinal cord ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 11 12 16 17 18
cochlea
weak weak
regionalweak expression: see section 01 02 03 04 06 17 18 19 20 21
neural retina
weak weak
regionalweak expression: see section 01 02 21 22
esophagus
moderate moderate
regionalmoderate expression: see section 12 13
lung
weak weak
regionalweak expression: see section 06 07 08 09 11 12 15 16 17 18 19 20 21 22
axial skeleton
weak weak
regionalweak expression: see section 13 14 15
axial skeleton tail region
weak weak
regionalweak expression: see section 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T51033
Entity Detected:Slc27a1, solute carrier family 27 (fatty acid transporter), member 1 ( MGI:1347098)
Sequence:sense strand is shown

>T51033
TGCTAGTGATGGACGAGCTGGGCTACATGTATTTCCGTGACCGCAGCGGGGACACCTTCCGCTGGCGCGG
GGAGAACGTGTCCACCACGGAGGTGGAAGCCGTGCTGAGCCGCCTACTGGGCCAGACGGACGTGGCTGTG
TATGGGGTGGCTGTGCCAGGAGTGGAGGGGAAAGCTGGCATGGCAGCCATCGCAGATCCCCACAGCCAGT
TGGACCCTAACTCAATGTACCAGGAATTACAGAAGGTTCTTGCATCCTATGCTCGGCCCATCTTCCTGCG
TCTTCTGCCCCAGGTGGATACCACAGGCACCTTCAAGATCCAGAAGACCCGGCTGCAGCGTGAAGGCTTT
GACCCCCGTCAGACCTCAGACAGGCTCTTCTTTCTAGACCTGAAGCAGGGACGCTATGTACCCCTGGATG
AGAGAGTCCATGCCCGCATTTGTGCAGGCGACTTCTCACTCTGAGCCTGGAGAGTGGGCTGGGCCTGGAC
TCCTGAGACCTGGGAGCCTGACACCCCTCTTCGGGTGCTTCTCCTGCCTGGCCACATGGACAGCAGCACC
TGTGAGAGTAGGAAAATGGAACCTGAGTGGCTGGGACCCCTCTCCTACTTCCCACTATGCATCCATTTTG
CCTCTGCCTTGATCTTTTTCTCCATCTCTTTTCTCCCTACCCAGCAGGAGCCCCACAAACACATGTTGGC
TGCTGTGTCCTGCAGTTGGACCAGTGTCCAGGGGTACAGGCTTCAGGCTGTGACCCACACTGGTACCCAC
CTCCCTTTCCTATTGTGCCTTAGGTTCATCCACGGTTCCCCTGTGGAGCAAGTGGGGGCCCACATAGCTG
CTGTCCCTGCTGAGGGTTGGTAGCAATCACACCCTCATGTCAGCTGGGAGACA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TGCTAGTGATGGACGAGCTG; Reverse Primer - name:unspecified, sequence:TGTCTCCCAGCTGACATGAG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10269 same embryo
 EMAGE:10271 same embryo
 EurExpress:euxassay_018940 same experiment
 MGI:4828170 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS