Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10331

Acot1 acyl-CoA thioesterase 1 ( MGI:1349396)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331
"Pseudo-wholemount" of euxassay_018932. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018932_01 euxassay_018932_02 euxassay_018932_03 euxassay_018932_04
EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331
euxassay_018932_05 euxassay_018932_06 euxassay_018932_07 euxassay_018932_08 euxassay_018932_09
EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331
euxassay_018932_10 euxassay_018932_11 euxassay_018932_12 euxassay_018932_13 euxassay_018932_14
EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331
euxassay_018932_15 euxassay_018932_16 euxassay_018932_17 euxassay_018932_18 euxassay_018932_19
EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331 EMAGE:10331
euxassay_018932_20 euxassay_018932_21 euxassay_018932_22 euxassay_018932_23 euxassay_018932_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10331Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10331_wholemount_strong.wlz
10331_wholemount_moderate.wlz
10331_wholemount_weak.wlz
10331_wholemount_possible.wlz
10331_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10331_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
axial musculature
moderate moderate
regionalmoderate expression: see section 06 07 10 weak expression: see section 08 09 23 24
thymus primordium
weak weak
regionalweak expression: see section 14 17 18
submandibular gland primordium
strong strong
regionalstrong expression: see section 08 09 10 11 12 18 19 20 21 22
pancreas
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 weak expression: see section 19
thyroid gland
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 13 17 18
vibrissa
strong strong
regionalstrong expression: see section 04 07 08 21 22 23 24 moderate expression: see section 05 06
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13 14 15 16
olfactory cortex ventricular layer
strong strong
regionalstrong expression: see section 11 12 moderate expression: see section 16 17 18
telencephalon ventricular layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 10 11 12 moderate expression: see section 02 09 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate ventricular layer
moderate moderate
homogeneousmoderate expression: see section 13 14 18
medulla oblongata basal plate ventricular layer
strong strong
homogeneousstrong expression: see section 16 moderate expression: see section 11 12 13 14 15 17 18
rest of cerebellum ventricular layer
strong strong
homogeneousstrong expression: see section 08 moderate expression: see section 06 07 09 10 11 12 14 15 20 21 22 23
pons ventricular layer
strong strong
homogeneousstrong expression: see section 08 16 moderate expression: see section 09 10 11 12 13 14 15 17 18 19 20 21
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 10 11 12 moderate expression: see section 09 13 14 15 16 17 18 19
intermediate grey horn
moderate moderate
regionalmoderate expression: see section 14 15 16 17
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 24
nasal septum
weak weak
regionalweak expression: see section 13 15
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
esophagus
weak weak
regionalweak expression: see section 15
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 weak expression: see section 08
midgut
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 20 21 22
liver lobe
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
lung
strong strong
regionalstrong expression: see section 07 08 09 10 11 moderate expression: see section 06 12 13 14 15 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50065
Entity Detected:Acot1, acyl-CoA thioesterase 1 ( MGI:1349396)
Sequence:sense strand is shown

>T50065
TCATGGCTCTGGCTTATTACAACTACGATGACCTCCCCAAGAACATGGAAACCATGCACATGGAGTACTT
TGAAGAAGCCGTGAACTACCTGCGCAGCCACCCCGAGGTAAAAGGACCTGGAATTGGGCTGCTTGGGATT
TCCAAAGGGGGTGAACTTGGCCTTGCTATGGCCTCCTTCCTGAAGGGCATCACAGCTGCTGTGGTCATCA
ATGGCTCCGTGGCTGCTGTTGGGAACACCATCTCCTACAAGGATGAGACTATACCCCCTGTGACTATCCT
GAGAAATCAGGTCAAAATGACCAAGGATGGCCTCAAGGATGTTGTAGATGCTTTGCAAAGCCCTCTGGTA
GACAAGAAGAGCTTCATTCCCGTGGAAAGGTCTGACACGACCTTCCTGTTCCTCGTAGGTCAGGACGACC
ACAACTGGAAGAGCGAGTTCTATGCTGATGAGATCTCCAAACGCCTGCAGGCGCACGGGAAGGAGAAGCC
CCAGATCATCTGCTACCCAGCAGCAGGGCATTACATCGAGCCCCCTTACTTCCCGCTGTGCAGCGCTGGC
ATGCACCTCCTGGTGGGTGCCAACATCACCTTTGGAGGGGAGCCCAAGCCTCATGCCATGGCCCAGTTGG
ATGCATGGCAGCAGCTCCAGACTTTCTTCCACAAACAGTTGGGTAGTGAGTGTTTGCATGTGTCTCCTAA
AATATAACCTATTATATGATGGTTTGGAGGTTGGGGAAAGGTACAAATACATTGTAAGAATATCATTTCA
GATGACTTCATCTGAACATAAAACTGCTTTAGATTTACATTTAAAAAAATTGATATAATTATCAAAATAG
TGCTGATTCAAGGGCTGGGAATGGAGTTTCATTGTCAAGTCCTTGACTGGCGCATGCAGGATCCTGGGTT
CAATCCAGCTGCGAGAAATAAAGCACGTTCTA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TCATGGCTCTGGCTTATTAC; Reverse Primer - name:unspecified, sequence:TAGAACGTGCTTTATTTCTC. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10330 same embryo
 EMAGE:10332 same embryo
 EurExpress:euxassay_018932 same experiment
 MGI:4822924 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS