Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10336

Sod2 superoxide dismutase 2, mitochondrial ( MGI:98352)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336
"Pseudo-wholemount" of euxassay_018920. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018920_01 euxassay_018920_02 euxassay_018920_03 euxassay_018920_04
EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336
euxassay_018920_05 euxassay_018920_06 euxassay_018920_07 euxassay_018920_08 euxassay_018920_09
EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336
euxassay_018920_10 euxassay_018920_11 euxassay_018920_12 euxassay_018920_13 euxassay_018920_14
EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336
euxassay_018920_15 euxassay_018920_16 euxassay_018920_17 euxassay_018920_18 euxassay_018920_19
EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336 EMAGE:10336
euxassay_018920_20 euxassay_018920_21 euxassay_018920_22 euxassay_018920_23 euxassay_018920_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10336Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10336_wholemount_strong.wlz
10336_wholemount_moderate.wlz
10336_wholemount_weak.wlz
10336_wholemount_possible.wlz
10336_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10336_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 12 13 14 15 16
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 19 20 weak expression: see section 07 08 09 10 17 18
thyroid gland
weak weak
regionalweak expression: see section 11 12 16
vibrissa
moderate moderate
regionalmoderate expression: see section 21 22 weak expression: see section 05 06 07 20
cerebral cortex mantle layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 16 17 18 19 20
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 16 17 weak expression: see section 09 14 15
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 09 10 16 17
pons mantle layer
weak weak
regionalweak expression: see section 07 18
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 13 14 15 16 weak expression: see section 11 12
facial vii ganglion
weak weak
regionalweak expression: see section 04 05 06 20 21 22
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 19 weak expression: see section 07 08
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 19 23 weak expression: see section 04 05 06 07 08 09 18 20 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 09 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 18 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 weak expression: see section 12 13 14 15 16 17 18
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 11
cervical ganglion
weak weak
regionalweak expression: see section 10
thoracic ganglion
weak weak
regionalweak expression: see section 14 15 16
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 17 18 19 20 weak expression: see section 08 11 12 13 14
neural retina
weak weak
regionalweak expression: see section 01 02 03 23 24
heart ventricle
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
mandible
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 15 18 19 20 21 22 23 24
lower jaw incisor
weak weak
regionalweak expression: see section 15
maxilla
weak weak
regionalweak expression: see section 05 06 07 08 09 18 19 20 21 22
lung
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 16 18 19 20 21 22 23 24
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 22 23 weak expression: see section 03 04 05 21
clavicle
moderate moderate
regionalmoderate expression: see section 17 18 weak expression: see section 09 10 11 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T51078
Entity Detected:Sod2, superoxide dismutase 2, mitochondrial ( MGI:98352)
Sequence:sense strand is shown

>T51078
TCGTGTAAACCTCAATAATGTTGTGTCGGGCGGCGTGCAGCACGGGCAGGAGGCTGGGCCCTGTGGCCGG
TGCCGCGGGCTCCCGGCACAAGCACAGCCTCCCAGACCTGCCTTACGACTATGGCGCGCTGGAGCCACAC
ATTAACGCGCAGATCATGCAGCTGCACCACAGCAAGCACCACGCGGCCTACGTGAACAATCTCAACGCCA
CCGAGGAGAAGTACCACGAGGCTCTGGCCAAGGGAGATGTTACAACTCAGGTCGCTCTTCAGCCTGCACT
GAAGTTCAATGGTGGGGGACATATTAATCACACCATTTTCTGGACAAACCTGAGCCCTAAGGGTGGTGGA
GAACCCAAAGGAGAGTTGCTGGAGGCTATCAAGCGTGACTTTGGGTCTTTTGAGAAGTTTAAGGAGAAGC
TGACAGCCGTGTCTGTGGGAGTCCAAGGTTCAGGCTGGGGCTGGCTTGGCTTCAATAAGGAGCAAGGTCG
CTTACAGATTGCTGCCTGCTCTAATCAGGACCCATTGCAAGGAACAACAGGCCTTATTCCGCTGCTGGGG
ATTGACGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAACGTCAGACCTGACTATCTGAAAGCTATTT
GGAATGTAATCAACTGGGAGAATGTTACTGAAAGATACACAGCTTGCAAGAAGTGAAACCTCACTCACGG
CCACATTGAGTGCCAGGCTCCGGGCTGGTTTATAGTAGTGTAGAGCATTGCAGCACTATGACTGGGGTGC
TGTAGTCTTTATTGATGTCTTTCCACATACCTGATAATTCTATGATAATTTCTTATTTTAATTAAATCTA
TTCTTAGGCAACTATTTGAGAACAGCGCATACTCTGTGTGAATTGCTCTTGATTGAACATTTTCGTTAGA
GCCTTGAATTGCTTGGATGCTA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TCGTGTAAACCTCAATAATG; Reverse Primer - name:unspecified, sequence:TAGCATCCAAGCAATTCAAG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10334 same embryo
 EMAGE:10337 same embryo
 EMAGE:10335 same embryo
 EurExpress:euxassay_018920 same experiment
 MGI:4828375 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS