Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10352

Cox4nb COX4 neighbor ( MGI:1343095)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10352 EMAGE:10352 EMAGE:10352 EMAGE:10352 EMAGE:10352
"Pseudo-wholemount" of euxassay_000557. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000557_01 euxassay_000557_02 euxassay_000557_03 euxassay_000557_04
EMAGE:10352 EMAGE:10352 EMAGE:10352 EMAGE:10352 EMAGE:10352
euxassay_000557_05 euxassay_000557_06 euxassay_000557_07 euxassay_000557_08 euxassay_000557_09
EMAGE:10352 EMAGE:10352 EMAGE:10352 EMAGE:10352 EMAGE:10352
euxassay_000557_10 euxassay_000557_11 euxassay_000557_12 euxassay_000557_13 euxassay_000557_14
EMAGE:10352 EMAGE:10352 EMAGE:10352 EMAGE:10352 EMAGE:10352
euxassay_000557_15 euxassay_000557_16 euxassay_000557_17 euxassay_000557_18 euxassay_000557_19
EMAGE:10352 EMAGE:10352
euxassay_000557_20 euxassay_000557_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10352Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10352_wholemount_strong.wlz
10352_wholemount_moderate.wlz
10352_wholemount_weak.wlz
10352_wholemount_possible.wlz
10352_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10352_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
homogeneousmoderate expression: see section 01
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 10 15 17 18 19 20 moderate expression: see section 01 02 03 04 05 06 07 08 09 11 12
midbrain ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 16 moderate expression: see section 07 08 09 12 13
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13
upper jaw tooth
moderate moderate
regionalmoderate expression: see section 13
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 12 13
metanephros
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3561
Entity Detected:Cox4nb, COX4 neighbor ( MGI:1343095)
Sequence:sense strand is shown

>T3561
TGGCCTCGAGCCAGATTCGGACGAGGTTTCCGGCCGACCGGCTGAGGCGGGAGGCCGCGGCCGGAGGTGC
GAGAGCGTCACGGCGTGCAGCGGAGGGTCGTGGCGGAGGACCGCGGTGCGTGGGTCGCGATGCCCGGCGT
GAAGCTGACTACGCAGGCCTACTGCAAGATGGTGCTCCACGGCGCCAAGTACCCGCACTGCGCCGTCAAC
GGGCTCCTGGTGGCCGAGAGGCAGAGGCCGCGCAAGGAGCATCCTCCCGGAGCGGGCAGCCACACGCTCT
TCGTGGACTGCATCCCGCTCTTCCACGGCACGCTGGCTCTGACGCCCATGCTGGAGGTGGCGCTCACCCT
GATTGACTCGTGGTGCAAAGACAACAGCTATGTGATCGCTGGCTATTACCAAGCTAATGAGCGTGTGAAG
GATGCCAGCCCAAACCAGGTGGCAGAAAAGGTGGCCTCCAGGATCGCAGAGGGCTTCGGTGATGCCGCAC
TCATCATGGTGGACAATGCCAAGTTCACGATGGACTGCGCAGCGCCCACGATCCACGTGT
Notes:The probe template was PCR amplified from IMAGE:3167033 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3167033 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10351 same embryo
 EurExpress:euxassay_000557 same experiment
 MGI:4824018 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS