Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10384

Cth cystathionase (cystathionine gamma-lyase) ( MGI:1339968)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384
"Pseudo-wholemount" of euxassay_000513. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000513_01 euxassay_000513_02 euxassay_000513_03 euxassay_000513_04
EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384
euxassay_000513_05 euxassay_000513_06 euxassay_000513_07 euxassay_000513_08 euxassay_000513_09
EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384
euxassay_000513_10 euxassay_000513_11 euxassay_000513_12 euxassay_000513_13 euxassay_000513_14
EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384
euxassay_000513_15 euxassay_000513_16 euxassay_000513_17 euxassay_000513_18 euxassay_000513_19
EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384 EMAGE:10384
euxassay_000513_20 euxassay_000513_21 euxassay_000513_22 euxassay_000513_23 euxassay_000513_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10384Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10384_wholemount_strong.wlz
10384_wholemount_moderate.wlz
10384_wholemount_weak.wlz
10384_wholemount_possible.wlz
10384_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10384_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
head mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 11 12 18 19 20 21 22 23 24
otic capsule
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 09 10 17 18 19 20 21 22 23 24
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
esophagus
moderate moderate
regionalmoderate expression: see section 13
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16
axial skeleton
weak weak
regionalweak expression: see section 10 11 13 14 15 16 17
cranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1750
Entity Detected:Cth, cystathionase (cystathionine gamma-lyase) ( MGI:1339968)
Sequence:sense strand is shown

>T1750
TGGCCTCGAGGCCAGATTCGGCACGAGGTGTTTACTCTGGCAGAGAGCCTGGGAGGATATGAGAGTCTGG
CTGAGCTTCCAGCAATCATGACCCATGCCTCTGTGCCTGAGAAGGACAGAGCTACCCTCGGGATCAATGA
CACACTGATACGACTTTCTGTGGGCCTAGAGGATGAACAGGACCTTCTTGAAGACCTGGATCGAGCTTTG
AAGGCAGCGCACCCTTAAAAGTTCGAGTCAAAGC
Notes:The probe template was PCR amplified from IMAGE:482400 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:482400 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10385 same assay
 EurExpress:euxassay_000513 same experiment
 MGI:4824103 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS