Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10427

Azi1 5-azacytidine induced gene 1 ( MGI:107440)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10427 EMAGE:10427 EMAGE:10427 EMAGE:10427 EMAGE:10427
"Pseudo-wholemount" of euxassay_000539. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000539_01 euxassay_000539_02 euxassay_000539_03 euxassay_000539_04
EMAGE:10427 EMAGE:10427 EMAGE:10427 EMAGE:10427 EMAGE:10427
euxassay_000539_05 euxassay_000539_06 euxassay_000539_07 euxassay_000539_08 euxassay_000539_09
EMAGE:10427 EMAGE:10427 EMAGE:10427 EMAGE:10427 EMAGE:10427
euxassay_000539_10 euxassay_000539_11 euxassay_000539_12 euxassay_000539_13 euxassay_000539_14
EMAGE:10427 EMAGE:10427 EMAGE:10427 EMAGE:10427 EMAGE:10427
euxassay_000539_15 euxassay_000539_16 euxassay_000539_17 euxassay_000539_18 euxassay_000539_19
EMAGE:10427 EMAGE:10427 EMAGE:10427 EMAGE:10427
euxassay_000539_20 euxassay_000539_21 euxassay_000539_22 euxassay_000539_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10427Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10427_wholemount_strong.wlz
10427_wholemount_moderate.wlz
10427_wholemount_weak.wlz
10427_wholemount_possible.wlz
10427_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10427_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Annotation Validation: spatial mapping by EMAGE editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3858
Entity Detected:Azi1, 5-azacytidine induced gene 1 ( MGI:107440)
Sequence:sense strand is shown

>T3858
TGGCCTCGAGCCAGATTCGGCACGAGGCCTCGTGCCGAGGCCCGCCAGCAGGTGGAGCTAGACGAGGTGC
ACCGGAGGGTGAAGACGGCTCTAGCGAGGAAGGAGGCAGCCGTGAACAGTCTCCGCAAACAGCATGAGGC
TGCTGTGAAGCGGGCGGACCACCTAGAGGAACTGCTGGAGCAACACAAAGGGTCATCTCTGAGTTCTAAG
TGACATCGCCCTTGGGATGACGAGCCAAGCCTGAGGCTGACACTCAGTCCTGCGGCTGGTGTCCAGGTCA
CGCTCCAAGACACAGGGCTAAGGGTAGGACAGCAGCTGGTGTGTGAGAGGCACCATGGAGCCCAGTGCCC
GGGACGTTACTGTCAGCATGCCTGCAGCTGTTCTATAGTAAAATGGTTAGGTGGCTTTTTTTAACTGCNA
AAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:424580 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:424580 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10430 same embryo
 EMAGE:10429 same embryo
 EMAGE:10428 same embryo
 EurExpress:euxassay_000539 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS