Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10572

Rfx5 regulatory factor X, 5 (influences HLA class II expression) ( MGI:1858421)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10572 EMAGE:10572 EMAGE:10572 EMAGE:10572 EMAGE:10572
"Pseudo-wholemount" of euxassay_000805. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000805_01 euxassay_000805_02 euxassay_000805_03 euxassay_000805_04
EMAGE:10572 EMAGE:10572 EMAGE:10572 EMAGE:10572 EMAGE:10572
euxassay_000805_05 euxassay_000805_06 euxassay_000805_07 euxassay_000805_08 euxassay_000805_09
EMAGE:10572 EMAGE:10572 EMAGE:10572 EMAGE:10572 EMAGE:10572
euxassay_000805_10 euxassay_000805_11 euxassay_000805_12 euxassay_000805_13 euxassay_000805_14
EMAGE:10572 EMAGE:10572 EMAGE:10572 EMAGE:10572 EMAGE:10572
euxassay_000805_15 euxassay_000805_16 euxassay_000805_17 euxassay_000805_18 euxassay_000805_19
EMAGE:10572 EMAGE:10572 EMAGE:10572 EMAGE:10572
euxassay_000805_20 euxassay_000805_21 euxassay_000805_22 euxassay_000805_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10572Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10572_wholemount_strong.wlz
10572_wholemount_moderate.wlz
10572_wholemount_weak.wlz
10572_wholemount_possible.wlz
10572_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10572_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 08 09 10 16 17 18 weak expression: see section 11
facial vii ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 21 22
inferior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 19 20 moderate expression: see section 08
superior glossopharyngeal ix ganglion
strong strong
homogeneousstrong expression: see section 19 20 moderate expression: see section 08
trigeminal v ganglion
strong strong
homogeneousstrong expression: see section 04 05 06 07 17 18 19 20 21 22 23 moderate expression: see section 08
vagus x ganglion
strong strong
homogeneousstrong expression: see section 09 10 17 18 not examined expression: see section 22
vestibulocochlear viii ganglion cochlear component
strong strong
homogeneousstrong expression: see section 07 19 20 moderate expression: see section 08
vestibulocochlear viii ganglion vestibular component
strong strong
homogeneousstrong expression: see section 05 06 07 18 19 20 21 22 moderate expression: see section 08
ventral grey horn
moderate moderate
regionalmoderate expression: see section 11 17
dorsal root ganglion
strong strong
homogeneousstrong expression: see section 09 10 11 12 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3872
Entity Detected:Rfx5, regulatory factor X, 5 (influences HLA class II expression) ( MGI:1858421)
Sequence:sense strand is shown

>T3872
TCCCAGAANTCCCCAGATGGAGGCTTGGGTGGAGGATGGAATTGTTGCTGGGGAGCAGCTAACGACCGCT
GGGTGCGGTTTAGCTTGCTAGGCTGGGATGAGCTGGACTGCTGCCTGTCCCCTGAACCTTGCATCTCCCT
CAGTGCAGCTCTAACTTTTATCTCATTGTAGCCTCGGAAGGACAGAGAAGGAAGCCATTCTCGTTAGTCT
CTTCATTCTTACAGGACAGCTTTCGCACCTCTGTCTCCCAGAACAAGCTCCTTTTAGGGTCTGAATCTTA
AACTTTCTCCGCAGCCGTGTTTCCTACCTCCCAACCTAGTGTCACCTTCTCAGAGGATATGAATGCCCCT
CCCAAGCCATTTCATTACATTACCTTCATTCTGCAGCCACCAGATGTCATGCACTTGTCACATGTGTCAG
GACCTAGCCAGGACTGTGGGCTTAGGCTGGATTAACAGATGCTGCGAGTCAGGGAGCACCTGCAGGAAGG
ATGCAGACGCTCCAGCTGTGTCCTTGGGAACAGCAGGAAACCAGCCCATATTAATCAA
Notes:The probe template was PCR amplified from IMAGE:944732 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:944732 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10573 same embryo
 EMAGE:10574 same embryo
 EMAGE:10575 same embryo
 EurExpress:euxassay_000805 same experiment
 MGI:4827707 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS