Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10577

Pfkp phosphofructokinase, platelet ( MGI:1891833)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10577 EMAGE:10577 EMAGE:10577 EMAGE:10577 EMAGE:10577
"Pseudo-wholemount" of euxassay_018981. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_018981_01 euxassay_018981_02 euxassay_018981_03 euxassay_018981_04
EMAGE:10577 EMAGE:10577 EMAGE:10577 EMAGE:10577 EMAGE:10577
euxassay_018981_05 euxassay_018981_06 euxassay_018981_07 euxassay_018981_08 euxassay_018981_09
EMAGE:10577 EMAGE:10577 EMAGE:10577 EMAGE:10577 EMAGE:10577
euxassay_018981_10 euxassay_018981_11 euxassay_018981_12 euxassay_018981_13 euxassay_018981_14
EMAGE:10577 EMAGE:10577 EMAGE:10577 EMAGE:10577 EMAGE:10577
euxassay_018981_15 euxassay_018981_16 euxassay_018981_17 euxassay_018981_18 euxassay_018981_19
EMAGE:10577
euxassay_018981_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10577Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10577_wholemount_strong.wlz
10577_wholemount_moderate.wlz
10577_wholemount_weak.wlz
10577_wholemount_possible.wlz
10577_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10577_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 weak expression: see section 05 06 07 15 16
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 15 17 18 19 20
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13 15 weak expression: see section 16
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 14 15 moderate expression: see section 05 13
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 12 13 14 15 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 12 13 14 15 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 08 09 10 12 13 14 weak expression: see section 11
facial vii ganglion
weak weak
regionalweak expression: see section 03 17 18
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 16
trigeminal v ganglion
weak weak
regionalweak expression: see section 03 04 05 06 07 08 16 17 18 19
ventral grey horn
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 07 08 09 12 14 15 16
neural retina
moderate moderate
regionalmoderate expression: see section 02
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T50692
Entity Detected:Pfkp, phosphofructokinase, platelet ( MGI:1891833)
Sequence:sense strand is shown

>T50692
AGTATGAGGCGAGCTATGACATGTCTGATTCAGGCAAGCTGGAGTCCTTGCAGCACCATGAAGAACTATG
AGCCATCTCATCAAGTCTGCCATCACCTGACCTGGAATGTTCTCCAGGGACCATCCTTTTTTGTAACATA
GTTATTTATCAGCACTTTATGGAAGCAAGCATTGTTGACGGAGTCAGCAGTAATAATCAGAGAGCACCAC
TTGCCATCACCACTGATGCAGCAGACCCTAAGACATGAAACCCAGCCTCACGCTATTGATCAGGTGTCAG
TTTTCTACTGTATGGGATACTGTCTTGTGCTTTACCATGTGTATGTCTTGTGGGATTAAACATTTGGTTA
CAACTCCCATGGTACTTGGTTTATTGTTTTAAGTAGGAGTCTGAAACAAGATGATTTTTTTCCATGCCAC
CAAAGGTTTCCTTCCTCAGCAGTCTTGTGGAGATTAGCAAAGTCTCCACAGATACTCCAGGGACACCAGG
GACATGTAGATAGGGGCCCCGCCTACTTCACTACTGCAAGCTAGGCTTATGATCTTTTCCAATCAGATCG
CATACAAATGCTAAAAGGACAACTATGAATTAGTGATTCTCAATTCCCCCTTAGTCGTATACAGCACAGC
TGCCAAGGCTTAGAAGGAGAAGCTGGTACCGGCCTCTTCTTCAAAAGCAGCCAGGGTGCTGGGTTTTCAC
CCTCTGGAAGATTTTGACTCACTGTTTAGGGTTAATGATTGGGTCCTTGGCAAAAGCCCATCCACTCCGC
CCTCCTCCGCCCCAGACTGATGAGCCGTCTGCAGGCAAAGCATCCCTGCCTCTTGTAAGGAGTCCGTGTG
CTCCCACTCTGCCTGAGCGTCCTCTAGCATCCACACAGCA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:AGTATGAGGCGAGCTATGAC; Reverse Primer - name:unspecified, sequence:TGCTGTGTGGATGCTAGAGG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10578 same embryo
 EMAGE:10580 same embryo
 EMAGE:10579 same embryo
 EMAGE:10576 same embryo
 EurExpress:euxassay_018981 same experiment
 MGI:4827167 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS