Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:106

Pax6 paired box gene 6 ( MGI:97490)
TS15 (9.0 dpc)
in situ hybridisation

Data Images
EMAGE:106
Fig 5A, Filosa et al., 1997 [PMID:9226455] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: There is a black bracket line indicating the ventral neural tube in this figure.
Expression Pattern Description
Spatial Annotation:
EMAGE:106Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
106_wholemount_strong_3D_1.wlz
106_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:106_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
future hindbrain
detected detected
regional
future forebrain
detected detected
regional
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:1277653
Entity Detected:Pax6, paired box gene 6 ( MGI:97490)
Sequence:sense strand is shown

>MGI:1277653
AATTCTGCAGACCCATGCAGATGCAAAAGTCCAGGTGCTGGACAATGAAAACGTATCCAACGGTTGTGTG
AGTAAAATTCTGGGCAGGTATTACGAGACTGGCTCCATCAGACCCAGGGCAATCGGAGGGAGTAAGCCAA
GAGTGGCGACTCCAGAAGTTGTAAGCAAAATAGCCCAGTATAAACGGGAGTGCCCTTCCATCTTTGCTTG
GGAAATCCGAGACAGATTATTATCCGAGGGGGTCTGTACCAACGATAACATACCCAGTGTGTCATCAATA
AACAGAGTTCTTCGCAACCTGG
nt 294 - nt 595 of X63963.1
Notes:The Pax6 probe used in this study by Filosa et al., 1997 [PMID:9226455] is described previously by Walther & Gruss, 1991 [PMID:1687460] ie: "an EcoRI-NheI-cDNA-fragment encoding most of the 3' part of the Pax-6 paired box." Editors note: Restriction analysis of the sequence from Walther & Gruss (X63963.1) indicates it is likely to be the EcoRI-NheI fragment extending between nt294 and nt595 as the paired box domain extends between nt172 and nt597.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Strain:(129/Sv x C57BL/6) x (129/Sv x CD1)F1
Age:9.0 dpc
Theiler Stage:TS15
Mutations:none (wild-type)
Preparation:wholemount
Procedures
Fixation:4% paraformaldehyde
General Information
Authors:Filosa et al., 1997 [PMID:9226455] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:9226455] Filosa S, Rivera-Perez JA, Gomez AP, Gansmuller A, Sasaki H, Behringer RR, Ang SL 1997 Goosecoid and HNF-3beta genetically interact to regulate neural tube patterning during mouse embryogenesis. Development (124):2843-54
 [ PMID:1687460] Walther C, Gruss P 1991 Pax-6, a murine paired box gene, is expressed in the developing CNS. Development (113):1435-49
Links:MGI:1338530 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI