EMAGE mouse gene expression spatial database

EMAGE:10612

Olfr589 olfactory receptor 589 ( MGI:3030423)
TS23 (14.5 dpc)
in situ hybridisation

Data Images


"Pseudo-wholemount" of euxassay_000988. This image has been made by aligning and collapsing the constitutent sections. Information about the method.	euxassay_000988_01	euxassay_000988_02	euxassay_000988_03	euxassay_000988_04

euxassay_000988_05	euxassay_000988_06	euxassay_000988_07	euxassay_000988_08	euxassay_000988_09

euxassay_000988_10	euxassay_000988_11	euxassay_000988_12	euxassay_000988_13	euxassay_000988_14

euxassay_000988_15	euxassay_000988_16	euxassay_000988_17	euxassay_000988_18	euxassay_000988_19

euxassay_000988_20	euxassay_000988_21	euxassay_000988_22	euxassay_000988_23

View assay images:
Expression pattern clarity:
Find spatially similar wholemount expression patterns:

Expression Pattern Description

Spatial Annotation:

Annotation colour key:

wholemount mapping

Download individual expression domains:

Download all expression domains:

Find spatially similar wholemount expression patterns:

Morphological match to the template:

Text Annotation:

Structure

Level

Pattern

Notes

nasal cavity olfactory epithelium

strong

single cell

strong expression: see section 16 08 moderate expression: see section 12 16 weak expression: see section 12 15

Annotation Validation:

spatial mapping by EMAGE editor, text annotation by author

Detection Reagent

Type:	in situ hybridisation probe
Identifier:	T5319
Entity Detected:	Olfr589, olfactory receptor 589 ( MGI:3030423)
Sequence:	sense strand is shown >T5319 GGCTTATGACCACTATGTGGCCATCTGTATCCCACTTCGGTACAGCACCATTCTCACCAATAAGGTCGTT TCTATGATTGGCATTGCTGTGCTAGTGAGGGCAATTATCTTTGTTATTCCATTTATATTTCTAATTTTGA GACTGCCCTTCTGTGGGCATCACATCATTCCCCATACCTACTGTGAGCACATGGGTCTTGCACGGCTGTC TTGTGCAAGTGTCAAGGCCAATGTAATTTATGGCTTATGTGCCATATGTAATCTACTGTTTGACATAGTA GCAATTGTTCTTTCTTACATACAAATATTACGTGTTGTGTTTCATCTCCCTTCTCGGGAAGCCCGGCTCA AGTCCCTCAACACTTGTGGTTCTCATGTCTGTGTCATCCTTGCCTTCTACACACCAGCCCTCTTTTCCTT CATGACACATC
Notes:	The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:GAAGACTGCCTGATACAGATG; Reverse Primer - name:unspecified, sequence:ATGTGTCATGAAGGAAAAGAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:	RNA
Strand:	antisense
Label:	digoxigenin

Specimen

Procedures

Fixation:	none
Embedding:	cryosection (OCT)
Staining procedure:	alkaline phosphatase + NBT/BCIP

General Information

Authors:	Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:	Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:	EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:	screen
References:	[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:	EMAGE:10609 same embryo
	EMAGE:10613 same embryo
	EMAGE:10611 same embryo
	EMAGE:10610 same embryo
	EurExpress:euxassay_000988 same experiment
	MGI:4826933 same experiment
	Ensembl same gene
	Allen Brain Atlas same gene
	BioGPS same gene
	International Mouse Knockout Project Status same gene
	GEISHA Chicken ISH Database same gene
	EMBL-EBI Gene Expression Atlas same gene
	BrainStars same gene
	ViBrism same gene
Data Source