Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10659

Mybl2 myeloblastosis oncogene-like 2 ( MGI:101785)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10659 EMAGE:10659 EMAGE:10659 EMAGE:10659 EMAGE:10659
"Pseudo-wholemount" of euxassay_000945. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000945_01 euxassay_000945_02 euxassay_000945_03 euxassay_000945_04
EMAGE:10659 EMAGE:10659 EMAGE:10659 EMAGE:10659 EMAGE:10659
euxassay_000945_05 euxassay_000945_06 euxassay_000945_07 euxassay_000945_08 euxassay_000945_09
EMAGE:10659 EMAGE:10659 EMAGE:10659 EMAGE:10659 EMAGE:10659
euxassay_000945_10 euxassay_000945_11 euxassay_000945_12 euxassay_000945_13 euxassay_000945_14
EMAGE:10659 EMAGE:10659 EMAGE:10659 EMAGE:10659 EMAGE:10659
euxassay_000945_15 euxassay_000945_16 euxassay_000945_17 euxassay_000945_18 euxassay_000945_19
EMAGE:10659 EMAGE:10659 EMAGE:10659 EMAGE:10659
euxassay_000945_20 euxassay_000945_21 euxassay_000945_22 euxassay_000945_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10659Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10659_wholemount_strong.wlz
10659_wholemount_moderate.wlz
10659_wholemount_weak.wlz
10659_wholemount_possible.wlz
10659_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10659_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 12 16 weak expression: see section 13 14 15
not examined not examined
homogeneousnot examined expression: see section 16
diencephalon lateral wall ventricular layer
moderate moderate
homogeneousmoderate expression: see section 11 12 13
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 09 moderate expression: see section 10 14 15 16
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 05 08 09 moderate expression: see section 01 02 03 04 06 07 10 11 12 13 14 15 16 17 18 19 20 21 22
cerebellum intraventricular portion ventricular layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 20 21 22 weak expression: see section 06 07 08 09 10 16 17 18 19
midbrain ventricular layer
moderate moderate
homogeneousmoderate expression: see section 08 09 10 11 12 13 14 15 16 weak expression: see section 07
liver lobe
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
skeleton
weak weak
regionalweak expression: see section 01 02 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T421
Entity Detected:Mybl2, myeloblastosis oncogene-like 2 ( MGI:101785)
Sequence:sense strand is shown

>T421
GGACAATGCTGTGAAGAATCACTGGAACTCCACTATCTAAGGAAAGTCGACACGGGAGGTTTCCCAGNCG
AGTCCAGNGACTGCAAGCCTGTCTACTTGCTCCTGGAGCTGGAGGACAAGGAACAGCACCAGGGTGTCCA
GCCGGTGGACGGCCAGGGAAGTCTCGTGAGCAGCTGGCCGCTGGTGCCCTCTATTGTGAAGGAGGAGAGC
AGCGAGGAGGAGATTGCCATAGCTGCTACTTCTGCTAAAGAACTCGGACATGAGCCTGTCCCTGCTGATC
TGGGAGAAGTGCGCACCCCAGAGCCCCCAGAATCTCTCAAGCGTGAATACCAGGAGTTCTCCTCCCCGGA
AACGAGCCTGCCCTACNAGTGGGTGGTAGAGGCGGCAAACCTCCTCATCCCGGCTGTGGGGTCCAGCCTC
TCTGAAGCTCTGGACTTGATTGAGTCGGACCCTGATGCTTGGTGCGACCTGAGTAAATTTGACCTTCCTG
AAGAAC
Notes:The probe template was PCR amplified from IMAGE:3157976 using vector specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:3157976 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10658 same embryo
 EMAGE:10657 same embryo
 EMAGE:10656 same embryo
 EMAGE:10655 same embryo
 EMAGE:10654 same embryo
 EurExpress:euxassay_000945 same experiment
 MGI:4826528 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS