Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10668

Hoxa6 homeobox A6 ( MGI:96178)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668
"Pseudo-wholemount" of euxassay_000982. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_000982_01 euxassay_000982_02 euxassay_000982_03 euxassay_000982_04
EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668
euxassay_000982_05 euxassay_000982_06 euxassay_000982_07 euxassay_000982_08 euxassay_000982_09
EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668
euxassay_000982_10 euxassay_000982_11 euxassay_000982_12 euxassay_000982_13 euxassay_000982_14
EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668
euxassay_000982_15 euxassay_000982_16 euxassay_000982_17 euxassay_000982_18 euxassay_000982_19
EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668 EMAGE:10668
euxassay_000982_20 euxassay_000982_21 euxassay_000982_22 euxassay_000982_23 euxassay_000982_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10668Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10668_wholemount_strong.wlz
10668_wholemount_moderate.wlz
10668_wholemount_weak.wlz
10668_wholemount_possible.wlz
10668_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10668_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 13 14 15 moderate expression: see section 12
spinal cord
strong strong
gradedstrong expression: see section 07 08 09 10 11 13 moderate expression: see section 14 15 16 17 weak expression: see section 12
dorsal grey horn
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15
ventral grey horn
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5313
Entity Detected:Hoxa6, homeobox A6 ( MGI:96178)
Sequence:sense strand is shown

>T5313
AGGACTCCTTCTTGGGCCAGCTGCCCCTCTACCCGGCCGGCTATGACGCGCTGAGGCCCTTCCCGGCCTC
TTACGGGGCGTCGAGTCTTCCGGACAAGACATACACCTCACCTTGTTTTTACCAACAGTCCAACTCGGTC
TTGGCCTGCAACCGGGCATCCTACGAGTACGGGGCCTCATGTTTCTATTCTGATAAAGACCTCAGTGGCG
CCTCACCCTCGGGCAATAACAAGCAGAGGGGCCCCGGGGACTACCTGCACTTTTCTCCCGAGCAGCAGTA
CAAACCTGACGGCAGCGTGCAGGGCAAAGCCCTCCATGAGGAAGGCACCGACCGGAAGTACACAA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:TGAGTTCCTATTTTGTGAATCC; Reverse Primer - name:unspecified, sequence:TAAACAGGGCTTGTGTACTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10667 same embryo
 EMAGE:10666 same embryo
 EurExpress:euxassay_000982 same experiment
 MGI:4825420 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS