Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10700

Scoc short coiled-coil protein ( MGI:1927654)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700
"Pseudo-wholemount" of euxassay_001052. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001052_01 euxassay_001052_02 euxassay_001052_03 euxassay_001052_04
EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700
euxassay_001052_05 euxassay_001052_06 euxassay_001052_07 euxassay_001052_08 euxassay_001052_09
EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700
euxassay_001052_10 euxassay_001052_11 euxassay_001052_12 euxassay_001052_13 euxassay_001052_14
EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700
euxassay_001052_15 euxassay_001052_16 euxassay_001052_17 euxassay_001052_18 euxassay_001052_19
EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700 EMAGE:10700
euxassay_001052_20 euxassay_001052_21 euxassay_001052_22 euxassay_001052_23 euxassay_001052_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10700Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10700_wholemount_strong.wlz
10700_wholemount_moderate.wlz
10700_wholemount_weak.wlz
10700_wholemount_possible.wlz
10700_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10700_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
weak weak
homogeneousweak expression: see section 04 06 07 20 21 22
glossopharyngeal ix ganglion
weak weak
homogeneousweak expression: see section 08 20
trigeminal v ganglion
weak weak
homogeneousweak expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
weak weak
homogeneousweak expression: see section 09 10 18 19
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1092
Entity Detected:Scoc, short coiled-coil protein ( MGI:1927654)
Sequence:sense strand is shown

>T1092
GTTGGCCTACTGGTTTGCTCATGAGCAAGATGGACGGATTGAGGACAGGGGAGGAGGAAGACAGCACGTT
CACCAGCATTTCTCTTGAAGATGACACAGACCATTCTTTAAAGAGTTGGCGTTCGAGGGCTGAAAGTCTG
CTACCCAAGATGATGAATGCTGACATGGACGCAGTTGATGCTGAAAATCAGGTGGAACTGGAAGAAAAGA
CTCGACTTATTAATCAGGTGTTGGAACTCCAACACACACTTGAAGATCTTTCTGCAAGAGTAGATGCAGT
TAAGGAAGAAAATCTGAAGCTAAAGTCGGAAAATCAAGTTCTCGGACAATATATAGAAAACCTCATGTCT
GCTTCTAGTGTTTTTCAAACAACTGATACAAAAAGCAAAAGGAAGTAAAGGGCTCACCTCCCTCTCTTCT
ATGGATTGCTGCTTTTTTTCTTCCCCCTTAAGGCTTGGATATGATCCAAAAGTTAGAGTATCTTTGTTCT
TCCCTGAGTATTTATAAAGAGAATGTCACATCTAGGTAACACTAATGCTGAACAGGAGCATCTCTGAGTT
AAC
Notes:The probe template was PCR amplified from IMAGE:2123211 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2123211 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10699 same embryo
 EMAGE:10698 same embryo
 EMAGE:10697 same embryo
 EMAGE:10696 same embryo
 EMAGE:10701 same embryo
 EurExpress:euxassay_001052 same experiment
 MGI:4827909 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS