Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10812

Tmed3 transmembrane emp24 domain containing 3 ( MGI:1913361)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812
"Pseudo-wholemount" of euxassay_001258. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001258_01 euxassay_001258_02 euxassay_001258_03 euxassay_001258_04
EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812
euxassay_001258_05 euxassay_001258_06 euxassay_001258_07 euxassay_001258_08 euxassay_001258_09
EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812
euxassay_001258_10 euxassay_001258_11 euxassay_001258_12 euxassay_001258_13 euxassay_001258_14
EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812
euxassay_001258_15 euxassay_001258_16 euxassay_001258_17 euxassay_001258_18 euxassay_001258_19
EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812 EMAGE:10812
euxassay_001258_20 euxassay_001258_21 euxassay_001258_22 euxassay_001258_23 euxassay_001258_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10812Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10812_wholemount_strong.wlz
10812_wholemount_moderate.wlz
10812_wholemount_weak.wlz
10812_wholemount_possible.wlz
10812_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10812_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 19 20 21 22 23 24
pancreas
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
nasal capsule
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 14 15 weak expression: see section 16 17 18
lower jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 19 20 21 22
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 14 15 weak expression: see section 16 17 18
upper jaw molar
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 19 20 21 22 weak expression: see section 18
axial skeleton
weak weak
regionalweak expression: see section 12 13 14 15 16
chondrocranium
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 23 24 weak expression: see section 06 07 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1126
Entity Detected:Tmed3, transmembrane emp24 domain containing 3 ( MGI:1913361)
Sequence:sense strand is shown

>T1126
GCTCCGCACGCTTCATCCTTCCAGATGCTGCTACAGCTGCTGCTTCTGCTCCTGCTCCGGGCCGAGCCAC
TGCGGAGCGCTGAGCTCACCTTCGAGCTGCCGGACAACGCCAAGCAGTGCTTCCACGAAGAGGTGGAGCA
GGGCGTGAAGTTCTCTCTGGATTACCAGGTTATCACTGGAGGCCACTACGATGTGGACTGCTATGTGGAA
GACCCCAGGGGCAACGTCATCTACAGGGAGACCAAGAAGCAGTATGACAGCTTCACGTACAAGACAGAGG
CCAAGGGCGTCTACCGGTTTTGCTTCAGTAATGAGTTCTCCACCTTCTCTCATAAGACCGTCTACTTTGA
CTTCCAAGTGGGTGACGAGCCCCCCATTCTCCCAGACATGGGGAACAGGGTCACGGCTCTCACTCAGATG
GAATCTGCCTGTGTAACTATTCACGAGGCTCTGAAGACTGTGATCGACT
Notes:The probe template was PCR amplified from IMAGE:2135538 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2135538 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10811 same embryo
 EMAGE:10809 same embryo
 EMAGE:10807 same embryo
 EMAGE:10808 same embryo
 EMAGE:10806 same embryo
 EMAGE:10810 same embryo
 EurExpress:euxassay_001258 same experiment
 MGI:4828760 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS