Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10836

Nsg1 neuron specific gene family member 1 ( MGI:109149)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836
"Pseudo-wholemount" of euxassay_001110. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001110_01 euxassay_001110_02 euxassay_001110_03 euxassay_001110_04
EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836
euxassay_001110_05 euxassay_001110_06 euxassay_001110_07 euxassay_001110_08 euxassay_001110_09
EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836
euxassay_001110_10 euxassay_001110_11 euxassay_001110_12 euxassay_001110_13 euxassay_001110_14
EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836
euxassay_001110_15 euxassay_001110_16 euxassay_001110_17 euxassay_001110_18 euxassay_001110_19
EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836 EMAGE:10836
euxassay_001110_20 euxassay_001110_21 euxassay_001110_22 euxassay_001110_23 euxassay_001110_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10836Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10836_wholemount_strong.wlz
10836_wholemount_moderate.wlz
10836_wholemount_weak.wlz
10836_wholemount_possible.wlz
10836_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10836_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
homogeneousmoderate expression: see section 06 07 08 21 22 23 24
glossopharyngeal ix ganglion
moderate moderate
homogeneousmoderate expression: see section 08 09 10 20 21 22
trigeminal v ganglion
moderate moderate
homogeneousmoderate expression: see section 05 06 07 08 09 10 11 19 20 21 22 23 24
vagus x ganglion
moderate moderate
homogeneousmoderate expression: see section 10 11 19 20
vestibulocochlear viii ganglion
moderate moderate
homogeneousmoderate expression: see section 07 08 09 10 19 20 21 22
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 19 20 21
nasal capsule
weak weak
regionalweak expression: see section 12 13 14 17 18 19
stomach
weak weak
homogeneousweak expression: see section 05 06 07 08 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1050
Entity Detected:Nsg1, neuron specific gene family member 1 ( MGI:109149)
Sequence:sense strand is shown

>T1050
CTGGATTGCTGTGCGCGGGAGCGGGCGACACTGAGCCTCGGAGCGCGCTTGGAGCCCAGATCTTCTGGAG
CCAGGCGTGGGGCCGCAGCCTCGTGTCCTTCGCAACCATGGTGAAGTTGGGGAATAATTTCGCAGAGAAG
GGCACCAAGCAGCCACTGCTGGAGGATGGCTTCGACACCATTCCTTTGATGACGCCCCTCGATGTCAACC
AGCTGCAGTTCNCACCCCCAGATAAGGTCGTGGTGAAAACTAAGACTGAATATGAACCTGATCGCAAAAA
AGGAAAAGCACGTCCTCCCAAGATAGCCGAGTTCACCGTCAGCATCACCGAGGGTGTCACCGAGAGGTTT
AAGGTCTCCGTGCTGGTCCTCTTTGCCCTGGCCTTCCTCACCTGTGTCGTCTTCCTGGTTGTCTACAAAG
TGTACAAGTATGACCGCGCCTGCCCTGATGGGTTTGTCTTGAAGAACACCCAGTGCATCCCAGAAGGCTT
GGAGAGCTACTACACGGAGCAAGACTCCAGTGCCCGGGAGAAATTTTACACTGTCATAAACCACTA
Notes:The probe template was PCR amplified from IMAGE:2088330 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:2088330 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10834 same embryo
 EMAGE:10835 same embryo
 EMAGE:10837 same embryo
 EurExpress:euxassay_001110 same experiment
 MGI:4826804 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS