Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:10848

Ndufa4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 ( MGI:107686)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:10848 EMAGE:10848 EMAGE:10848 EMAGE:10848 EMAGE:10848
"Pseudo-wholemount" of euxassay_003412. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003412_01 euxassay_003412_02 euxassay_003412_03 euxassay_003412_04
EMAGE:10848 EMAGE:10848 EMAGE:10848 EMAGE:10848 EMAGE:10848
euxassay_003412_05 euxassay_003412_06 euxassay_003412_07 euxassay_003412_08 euxassay_003412_09
EMAGE:10848 EMAGE:10848 EMAGE:10848 EMAGE:10848 EMAGE:10848
euxassay_003412_10 euxassay_003412_11 euxassay_003412_12 euxassay_003412_13 euxassay_003412_14
EMAGE:10848 EMAGE:10848 EMAGE:10848 EMAGE:10848 EMAGE:10848
euxassay_003412_15 euxassay_003412_16 euxassay_003412_17 euxassay_003412_18 euxassay_003412_19
EMAGE:10848 EMAGE:10848 EMAGE:10848 EMAGE:10848
euxassay_003412_20 euxassay_003412_21 euxassay_003412_22 euxassay_003412_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:10848Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
10848_wholemount_strong.wlz
10848_wholemount_moderate.wlz
10848_wholemount_weak.wlz
10848_wholemount_possible.wlz
10848_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:10848_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
adrenal gland
moderate moderate
regionalmoderate expression: see section 10 11 12 18 19 20
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 16 moderate expression: see section 12
submandibular gland primordium
strong strong
regionalstrong expression: see section 07 08 09 10 11 17 18 19 20
pancreas
moderate moderate
regionalmoderate expression: see section 11 12 13 14
brain
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
adenohypophysis
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15
vibrissa
strong strong
regionalstrong expression: see section 06 07 08 09 21 22 23
facial vii ganglion
strong strong
regionalstrong expression: see section 05 20 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 08 09 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 18 19 20 21 22
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 18
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 12 13 14 15 17 18 19
not examined not examined
regionalnot examined expression: see section 01 02 03 04
neural retina
weak weak
regionalweak expression: see section 01 02 03 04
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 18 moderate expression: see section 16 17 19 20
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 13 moderate expression: see section 14 15 17
heart
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
tongue
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
stomach
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11
midgut
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17 18 19 20 21 22
lower jaw incisor
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 14 15 16 17
lower jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 18 19 20
upper jaw incisor
strong strong
regionalstrong expression: see section 12 13 moderate expression: see section 14
upper jaw molar
moderate moderate
regionalmoderate expression: see section 07 08 09 18 19 20
liver
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
bladder
moderate moderate
regionalmoderate expression: see section 14 15 16 17
metanephros
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 19 20 21 22
lung
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 moderate expression: see section 21 23
not examined not examined
regionalnot examined expression: see section 08 09 10 11 12 13 14 15 17 18 19
not examined not examined
regionalnot examined expression: see section 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5938
Entity Detected:Ndufa4, NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 ( MGI:107686)
Sequence:sense strand is shown

>T5938
GTCCTAATCTTCTCTCTGCGTGTAGGTAGGCCTGTGCCGCAAACATGCTCCGCCAGATCCTCGGGCAAGC
CAAGAAGCATCCCAGCTTGATTCCTCTCTTCGTATTTATTGGAGCAGGGGGTACTGGAGCAGCACTGTAT
GTGATGCGCTTGGCACTGTTTAATCCAGATGTCAGCTGGGACAGAAAGAACAACCCAGAGCCATGGAACA
AACTGGGTCCCAATGAACAATATAAGTTCTACTCTGTGAATGTGGACTACAGCAAACTGAAGAAAGAAGG
CCCAGACTTCTAAACTATGAAGTTCACTGTAAAGCTGCTGATAATGAAGGTCTTTCAGAAGCCATCCGCA
CAATTTTCCACTTAAGCAGGAAATATGTCTCTGAATGCATGAAATCATGTTGATTTTTTTTTTTTTTGGA
GTTTATTACACTGATGAATAAATCTCTGAAACTTGAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3483028 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3483028 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:10851 same embryo
 EMAGE:10846 same embryo
 EMAGE:10850 same embryo
 EMAGE:10849 same embryo
 EMAGE:10847 same embryo
 EurExpress:euxassay_003412 same experiment
 MGI:4826638 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS