Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11134

Sh3bgrl3 SH3 domain binding glutamic acid-rich protein-like 3 ( MGI:1920973)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11134 EMAGE:11134 EMAGE:11134 EMAGE:11134 EMAGE:11134
"Pseudo-wholemount" of euxassay_003517. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003517_01 euxassay_003517_02 euxassay_003517_03 euxassay_003517_04
EMAGE:11134 EMAGE:11134 EMAGE:11134 EMAGE:11134 EMAGE:11134
euxassay_003517_05 euxassay_003517_06 euxassay_003517_07 euxassay_003517_08 euxassay_003517_09
EMAGE:11134 EMAGE:11134 EMAGE:11134 EMAGE:11134 EMAGE:11134
euxassay_003517_10 euxassay_003517_11 euxassay_003517_12 euxassay_003517_13 euxassay_003517_14
EMAGE:11134 EMAGE:11134 EMAGE:11134 EMAGE:11134 EMAGE:11134
euxassay_003517_15 euxassay_003517_16 euxassay_003517_17 euxassay_003517_18 euxassay_003517_19
EMAGE:11134 EMAGE:11134 EMAGE:11134 EMAGE:11134
euxassay_003517_20 euxassay_003517_21 euxassay_003517_22 euxassay_003517_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11134Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11134_wholemount_strong.wlz
11134_wholemount_moderate.wlz
11134_wholemount_weak.wlz
11134_wholemount_possible.wlz
11134_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11134_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
moderate moderate
homogeneousmoderate expression: see section 10 11 12 13 14 15
medulla oblongata basal plate
moderate moderate
regionalmoderate expression: see section 07 08 09 10 12 14 15 16
metencephalon basal plate
moderate moderate
regionalmoderate expression: see section 06 16
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 03 04 19 20 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 17 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 16 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 17
ventral grey horn
moderate moderate
regionalmoderate expression: see section 09 14 15 weak expression: see section 10 11 12 13
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T5918
Entity Detected:Sh3bgrl3, SH3 domain binding glutamic acid-rich protein-like 3 ( MGI:1920973)
Sequence:sense strand is shown

>T5918
CTCCCAAGCGCGGCGGCGGCAGCGTAGTTCCTAGCCGTGCAGCTGCCGCTCCCACCGTCCCTCAGTTGGT
CTGTGTCCCCCGCCTGCAGCATGAGTGGCCTGCGCGTCTACAGCACGTCGGTCACCGGCTCCCGAGAAAT
CAAGTCCCAGCAGAGTGAGGTGACCCGCATCCTAGATGGGAAGAGGATCCAATACCAGCTAGTGGACATC
TCCCAGGACAACGCCCTTCGAGATGAGATGCGAACCTTGGCTGGCAACCCCAAAGCTACCCCACCTCAGA
TTGTCAACGGGAACCACTACTGTGGGGACTATGAACTCTTCGTGGAGGCCGTGGAGCAGGACACACTGCA
GGAGTTCCTGAAGCTGGCCTGAGTCAGGATGGCCACCGATCCTATCCAGCTAGCTCTTCACCAGGCCTTG
TAACCAACTCCTTGTCGTCCTAATCTGCAAACCCAGACCCAGACCCTTTCCGCAGCCGCCTCCTCTTCCT
CCAGAGGCAACATTCCTTATTCACCAACTAGTCTCAAAAGATTGTCTTAAGCCCTGACGATGACTGTCCC
CAGCCACACCTTGGGGCATCCTCTCTGCCTGGCCCTGTCTGATGAGCATTTCTGTTGCTTCCATCAGCCA
GAGCTCTGCCAAAGGCCCCGCATCCCCATCCTAGGAGTGCCCTAGAGACAATTAAATGTCCATTCCTCTG
GTGCTGAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:3481987 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:3481987 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11139 same embryo
 EMAGE:11138 same embryo
 EMAGE:11137 same embryo
 EMAGE:11136 same embryo
 EMAGE:11135 same embryo
 EurExpress:euxassay_003517 same experiment
 MGI:4828035 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS