Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11175

Magel2 melanoma antigen, family L, 2 ( MGI:1351648)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11175 EMAGE:11175 EMAGE:11175 EMAGE:11175 EMAGE:11175
"Pseudo-wholemount" of euxassay_003512. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_003512_01 euxassay_003512_02 euxassay_003512_03 euxassay_003512_04
EMAGE:11175 EMAGE:11175 EMAGE:11175 EMAGE:11175 EMAGE:11175
euxassay_003512_05 euxassay_003512_06 euxassay_003512_07 euxassay_003512_08 euxassay_003512_09
EMAGE:11175 EMAGE:11175 EMAGE:11175 EMAGE:11175 EMAGE:11175
euxassay_003512_10 euxassay_003512_11 euxassay_003512_12 euxassay_003512_13 euxassay_003512_14
EMAGE:11175 EMAGE:11175 EMAGE:11175 EMAGE:11175 EMAGE:11175
euxassay_003512_15 euxassay_003512_16 euxassay_003512_17 euxassay_003512_18 euxassay_003512_19
EMAGE:11175 EMAGE:11175 EMAGE:11175 EMAGE:11175
euxassay_003512_20 euxassay_003512_21 euxassay_003512_22 euxassay_003512_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11175Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11175_wholemount_strong.wlz
11175_wholemount_moderate.wlz
11175_wholemount_weak.wlz
11175_wholemount_possible.wlz
11175_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11175_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diaphragm
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 20 21 22 weak expression: see section 08 09 19 23
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 weak expression: see section 23
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
cerebral cortex marginal layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21 22 weak expression: see section 03 04
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
tongue
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 moderate expression: see section 10
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1722
Entity Detected:Magel2, melanoma antigen, family L, 2 ( MGI:1351648)
Sequence:sense strand is shown

>T1722
AATTCGGACGAGGCTTTGNTGAGTTTCTCTTGGTCAAGACCAAGCCAAGGTGCCTGTCCAGCTCTCGGAG
ATGGTAAATGTTGTCATCCGAGAATACAAAGACGACAGCTTAGACATCATCAACCGTGCCAACACTAAGC
TGGAGTGCACCTTTGGTTGTCAACTGAAGGAAGTTGACACCAAAACCCACACTTACATCATCGTCAACAA
GATGGCGTACCCTCAGTGTAATTTGCTGGCATCCTATTTAGAGAGGCCAAAGTTCAGCCTCCTGATGGTG
GTCTTGAGCCTCATCTTTATGAAAGGCTACTGTATCAGGGAGAATCTGCTCTTTAGTTTTCTGTTCCAGC
TAGGGCTGGATGTCCAGGAGACAAGTGGTCTCTTCAGAATTACAAAGAAGCTCATCACCAGTGTGTTTGT
GAGACACAGGTACCTAGAGTACAGGCAAATCCCGTTCACTGAGCCTGCAGAATACGAGCTTCTCTGGGGG
CCCCGGGCATTCCTCGAAACCAACAGGGTGCACATCTTGAGATTTTTGGCCG
Notes:The probe template was PCR amplified from IMAGE:479471 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:479471 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11174 same embryo
 EMAGE:11172 same embryo
 EMAGE:11173 same embryo
 EMAGE:11170 same embryo
 EMAGE:11171 same embryo
 EurExpress:euxassay_003512 same experiment
 MGI:4826062 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS