Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11272

Hes6 hairy and enhancer of split 6 (Drosophila) ( MGI:1859852)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11272 EMAGE:11272 EMAGE:11272 EMAGE:11272 EMAGE:11272
"Pseudo-wholemount" of euxassay_006639. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006639_01 euxassay_006639_02 euxassay_006639_03 euxassay_006639_04
EMAGE:11272 EMAGE:11272 EMAGE:11272 EMAGE:11272 EMAGE:11272
euxassay_006639_05 euxassay_006639_06 euxassay_006639_07 euxassay_006639_08 euxassay_006639_09
EMAGE:11272 EMAGE:11272 EMAGE:11272 EMAGE:11272 EMAGE:11272
euxassay_006639_10 euxassay_006639_11 euxassay_006639_12 euxassay_006639_13 euxassay_006639_14
EMAGE:11272 EMAGE:11272 EMAGE:11272 EMAGE:11272 EMAGE:11272
euxassay_006639_15 euxassay_006639_16 euxassay_006639_17 euxassay_006639_18 euxassay_006639_19
EMAGE:11272 EMAGE:11272
euxassay_006639_20 euxassay_006639_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11272Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11272_wholemount_strong.wlz
11272_wholemount_moderate.wlz
11272_wholemount_weak.wlz
11272_wholemount_possible.wlz
11272_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11272_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
foot mesenchyme
strong strong
regionalstrong expression: see section 05 06 07 21
head mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 14 15 16 17 18 19 20 21
vertebral axis musculature
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
thymus primordium
strong strong
regionalstrong expression: see section 08 09 10 11 12
hypothalamus ventricular layer
strong strong
homogeneousstrong expression: see section 08 09 10 11 12
diencephalon lateral wall ventricular layer
strong strong
homogeneousstrong expression: see section 09 10 11
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 08 09 13 moderate expression: see section 15
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 16 17 18 19 20 moderate expression: see section 14 15
rest of cerebellum marginal layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
rest of cerebellum ventricular layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18
midbrain ventricular layer
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14
retina
strong strong
regionalstrong expression: see section 19 20 21
neural retina
strong strong
regionalstrong expression: see section 01
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 11 12 13 14 15 16 17
nasal cavity respiratory epithelium
strong strong
regionalstrong expression: see section 10 12
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 weak expression: see section 13 14
lower jaw molar
strong strong
regionalstrong expression: see section 04 16
upper jaw molar
strong strong
regionalstrong expression: see section 04 16
trachea
moderate moderate
regionalmoderate expression: see section 10
tail mesenchyme
strong strong
regionalstrong expression: see section 11 12 13 14 15 moderate expression: see section 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T7064
Entity Detected:Hes6, hairy and enhancer of split 6 (Drosophila) ( MGI:1859852)
Sequence:sense strand is shown

>T7064
GGCCTCCGGGCTGCGACCCACCTCACTGAGTGGTTTGCACTAGGGCGCCGGGCTCCGTAGACCATGGCTC
CGTCCCAGGCGCCCAGCCGGGACCGTGCAGGCCAGGAGGATGAGGACCGCTGGGAAGCACGGGGGGACCG
CAAGGCCCGGAAGCCCTTGGTGGAGAAGAAGCGACGCGCACGGATCAACGAGAGTCTTCAGGAGCTGCGG
CTGCTGCTGGCCGGTACCGAGGTGCAGGCCAAGCTAGAGAACGCCGAGGTTCTGGAGCTGACCGTGAGGC
GCGTGCAGGGCGCGCTGCGAGGCCGGGCGCGCGAGCGGGAGCAGCTGCAGGCTGAAGCAAGCGAGCGCTT
CGCTGCTGGCTACATCCAGTGCATGCATGAGGTGCACACGTTCGTGTCCACGTGCCAAGCCATCGATGCC
ACTGTCTCAGCTGAACTCCTGAACCACCTGCTAGAATCCATGCCACTGCGCGAGGGTAGCAGCTTTCAGG
ATCTGCTGGGGGACTCCCTAGCTGGGCTGCCTGGAGGCTCTGGGAGGAGCAGCTGGCCTCCAGGAGGGTC
CCCAGAATCCCCATTGTCCAGTCCCCCAGGTCCCGGGGACGACCTGTGTTCTGACCTAGAGGAGATCCCA
GAGGCTGAACTAAACCGGGTGCCTGCTGAGGGGCCGGATTTGGTGTCTACATCCTTAGGCAGCCTGACTG
CAGCTCGCCGGGCTCAGAGTGTGTGGAGGCCTTGGTGACCAACACTTACCAGGGACCTGTGAATGGTGGC
TGCCATCCTTAAGTTTGCTTCCTCCCTGGGTATCAGATAAGGTGGAGACAGCTCAGGATGCCCCCCAGGT
ATGCCCTCCCCACTCTCCAACAGATGACTTGAATGACAACCCTAATGGCCAGGCCCTGCAGGTCCCTAGC
ACTATTTTTTCGTGGACCCTAGAGCTCTGGATGGTGGCTGGGGGGCCAGGGGGTGCACTAAAGAAAGACA
GGAGACTTTTGGAGAGCTGCCAGGGCTCCCTCGTGTTCACCTCTCCCTGCCTTTTGGGCATTCTGAGGAT
CTAGGGCAGAAGTGGCCAATCTTGAGACTGAGCATTAGGGTCCTGGGCAGGGACACACAGGCCACAGCAA
TCCTGACCTGAAAGGAAGTTCCGATTTGCTACTTTGGCTATGAGACCAGGGGAGGTGGGCATATTCTGCA
GTCACTGAAGCTGCTCCTCGTTTGTAACACAGTTGCGCGCCTGTGAGTTTGGTTGCCATCTCATCGATGC
TCCAACCGAATTAAATAAAGAACTTTGGAGTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:4011223 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:4011223 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11274 same embryo
 EMAGE:11271 same embryo
 EMAGE:11273 same embryo
 EurExpress:euxassay_006639 same experiment
 MGI:4825361 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS