Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:113

Pou5f1 POU domain, class 5, transcription factor 1 ( MGI:101893)
TS11 (7.75 dpc)
in situ hybridisation

Data Images
EMAGE:113
Fig 4A, Perea-Gomez et al., 1999 [PMID:10498685] . Copyright: This image is from Development and is displayed with the permission of the Company of Biologists Ltd. who owns the copyright

Expression pattern clarity: two stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:113Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
113_wholemount_strong_3D_1.wlz
113_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:113_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
embryo ectoderm
detected detected
regionalExpression is restricted to ectoderm cells in the posterior half of wild-type embryos
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:3033352
Entity Detected:Pou5f1, POU domain, class 5, transcription factor 1 ( MGI:101893)
Sequence:sense strand is shown

>MGI:3033352
CGCCAGAAGGGCAAAAGATCAAGTATTGAGTATTCCCAACGAGAAGAGTATGAGGCTACAGGGACACCTT
TCCCAGGGGGGGCTGTATCCTTTCCTCTGCCCCCAGGTCCCCACTTTGGCACCCCAGGCTATGGAAGCCC
CCACTTCACCACACTCTACTCAGTCCCTTTTCCTGAGGGCGAGGCCTTTCCCTCTGTTCCCGTCACTGCT
CTGGGCTCTCCCATGCATTCAAACTGAGGCACCAGCCCTCCCTGGGGATGCTGTGAGCCAAGGCAAGGGA
GGTAGACAAGAGAACCTGGAGCTTTGGGGTTAAATTCTTTTACTGAGGAGGGATTAAAAGCACAACAGGG
GTGGGGGGTGGGATGGGGAAAGAAGCTCAGTGATGCTGTTGATCAGGAGCCTGGCCTGTCTGTCACTCAT
CATTTTGTTCTTAAATAAAGACTGGGACACACAGTAAAAAAAAAAA
nt 770 - nt 1235 of X52437.1
Notes:Pou5f1 (also known as Oct3 and/or Oct4) probe used in this study by Perea-Gomez et al., 1999 [PMID:10498685] is described previously by Rosner et al., 1990 [PMID:1972777] as corresponding to nucleotides 865-1325 of the Oct-3 cDNA (see Fig 1 in that paper for the sequence). Editor's Note: Start/end co-ordinates against X52437.1 were deduced using this information.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:7.75 dpc
Theiler Stage:TS11
Mutations:none (wild-type)
Preparation:wholemount
Procedures
General Information
Authors:Perea-Gomez et al., 1999 [PMID:10498685] Indexed by GXD, Spatially mapped by EMAGE
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ PMID:10498685] Perea-Gomez A, Shawlot W, Sasaki H, Behringer RR, Ang S 1999 HNF3beta and Lim1 interact in the visceral endoderm to regulate primitive streak formation and anterior-posterior polarity in the mouse embryo. Development (1999):4499-511
 [ doi:10.1038/345686a0] [ PMID:1972777] Rosner MH, Vigano MA, Ozato K, Timmons PM, Poirier F, Rigby PW, Staudt LM 1990 A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature (345):686-92
Links:MGI:1346197 same embryo
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI