Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11366

Ndufaf4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4 ( MGI:1915743)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11366 EMAGE:11366 EMAGE:11366 EMAGE:11366 EMAGE:11366
"Pseudo-wholemount" of euxassay_006782. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006782_01 euxassay_006782_02 euxassay_006782_03 euxassay_006782_04
EMAGE:11366 EMAGE:11366 EMAGE:11366 EMAGE:11366 EMAGE:11366
euxassay_006782_05 euxassay_006782_06 euxassay_006782_07 euxassay_006782_08 euxassay_006782_09
EMAGE:11366 EMAGE:11366 EMAGE:11366 EMAGE:11366 EMAGE:11366
euxassay_006782_10 euxassay_006782_11 euxassay_006782_12 euxassay_006782_13 euxassay_006782_14
EMAGE:11366 EMAGE:11366 EMAGE:11366 EMAGE:11366 EMAGE:11366
euxassay_006782_15 euxassay_006782_16 euxassay_006782_17 euxassay_006782_18 euxassay_006782_19
EMAGE:11366 EMAGE:11366 EMAGE:11366 EMAGE:11366
euxassay_006782_20 euxassay_006782_21 euxassay_006782_22 euxassay_006782_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11366Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11366_wholemount_strong.wlz
11366_wholemount_moderate.wlz
11366_wholemount_weak.wlz
11366_wholemount_possible.wlz
11366_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11366_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pectoral girdle and thoracic body wall musculature
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 19 20 21 22 23
submandibular gland primordium
strong strong
regionalstrong expression: see section 09 10 11 17 18 19 20 21 moderate expression: see section 08
vibrissa
moderate moderate
regionalmoderate expression: see section 09 10 11 22 23 weak expression: see section 08
esophagus epithelium
moderate moderate
regionalmoderate expression: see section 13
midgut
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 16 17 18 19 20 21 weak expression: see section 22
liver left lobe
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13
liver right lobe
moderate moderate
regionalmoderate expression: see section 14 15 16 17 18 19 20 21 22 23
metanephros
moderate moderate
regionalmoderate expression: see section 09 10 11 17 18 20 21 weak expression: see section 19
left lung
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12
right lung
moderate moderate
regionalmoderate expression: see section 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T8208
Entity Detected:Ndufaf4, NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4 ( MGI:1915743)
Sequence:sense strand is shown

>T8208
GTGCCGGTGGCTTCTACACGTGCGTAGTGAACTAAGGGCATCATGATTTAGAGATGGGGGCTCGCGTGAC
CCGCGCCTTAAGGAACTTCAACGTGGAGAAGCGAGCGGAGCGAGAGATCAGCAAGAGGAAGCCCTCCATG
GCACCCAAGCACCCTTCTACCCGCGACCTCCTGCAGGAGCACCGGAGTCAGTATCCAGAAATCGAAGAAG
TTGTTTCTAAAAAAGATAACAAGCTGCTGTCATTGCTAAGAGATGTATATGTCGATTCCAAAGATCCGGT
GCCTGCCTTGCCGGTAAAAGTTGAACCACGACAAGAACCAAAGGAATTCAGACTGCCGATAGGAAATCAC
TTTGATAAGAATATCACGGACATTCCCAAAGGCAAGATTACTGTTGTAGAGGCATTGACCCTTCTCAATA
ACCATAAACTCTCTCCAGAAACATGGACTGCTGAGAAAATCGCTCAAGAGTACTATTTAGAACTGAAGGA
TGTAAATTCCCTTCTCAAATATTTTGTTACTTTTGAAGTCAAAATCTTACCTCCAGAAGACAGGAAAGCA
ATACAATCAAAATGAAGAAAATCACGAAACAACTTCCCCTGTATGTGTTCCCAAGCTCCGCGCCCTTGTT
TTGCGTGTATTAAATTATACAAGTTCCTGTGAGTTGAGGGCCATAACGTTTGAAAGCTCTTTGACCTCCT
CAGGATTGTTCATATAATTTTTTAAAAATTTATGTATGTGTAGTTCCTGGGTATATGTTAGCTGTATTGA
TCATGTGGCCCAAATGAGTCAATATTAAATTCCACTTTCTAGTTTAAAAAAAAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:1195846 using vector (pT7T3D-PacI) specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T7 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:1195846 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11365 same embryo
 EMAGE:11367 same embryo
 EMAGE:11369 same embryo
 EMAGE:11368 same embryo
 EurExpress:euxassay_006782 same experiment
 MGI:4826644 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS